|
Purpose and background of cervical cancer is one of the most common gynecological malignancy, and ranks second in cancer-related cause of death in women. In recent years, with the incidence of sexually transmitted diseases has increased year by year, the rising incidence of cervical cancer and getting younger and younger. hWAPL gene cervical cancer-specific high-expressed genes discovered in recent years, with the characteristics of oncogenes. hWAPL gene of Drosophila the WAPL gene in the homologous sequence of the human body, about 30 793bp, located in 10q23.2, encodes a polymerization anchored protein, can be in prophase of chromosome arm a polymerization timely dissociation. The specific role of the mechanism is not very clear, but its overexpression is premature sister chromatid dissociation. About hWAPL gene expression in the organization of cervical cancer in women has not been reported, of the research hWAPL gene expression in cervical cancer tissue and its significance and to explore the development of cervical cancer. The first part hWAPL gene protein expression levels detected Materials and Methods immunohistochemical PV-9000 detected 413 cases of archived paraffin sections. Which normal cervical tissue 27 Li, cervical cancer 47 Li cervical intraepithelial neoplasia variable (CIN), Ⅰ 30 Li, CIN Ⅱ 33 Li, CIN Ⅲ 38 Li, gastric cancer 29 cases, liver cancer 28 Li, bladder cancer 26 Li, esophageal cancer 35 cases, uterine endometrial 25 cases of cancer, kidney cancer, 26 cases, 36 cases of rectal cancer, lung cancer, 33 cases. Combined with the percentage of positive cells using color intensity to the interpretation of the results. To cytoplasmic brown granules, 3 points; appear yellow granules, 2 points; out significant light yellow particles or yellow particles appear, 1 or 0, respectively. Positive cell rate of 6% to 25% points, 26% to 50%, 2 points, 51% to 75%, ≥ 76% 4. Staining intensity scores and positive cell rate score multiplied as the final score, ≥ 3 points were divided into positive expression cases. Experimental data using SPSS10.0 statistical software for analysis. Univariate analysis of variance between groups immune integral using x ~ 2 test between groups positive rate the inspection level α = 0.05. Results of normal cervical tissue only seen even a small amount of yellow granules in the cytoplasm of epithelial cells at the bottom of its base. Cell staining intensity gradually deepened, with the severity of cervical lesions, and the gradual increase in the proportion of positive staining cells. Cervical cancer epithelial the full layer cell cytoplasm were visible yellow or brown particles. hWAPL gene in gastric cancer, liver cancer, endometrial cancer, kidney cancer, colorectal cancer, lung cancer organizations yellow granules in the cytoplasm or occasionally scattered light yellow particles; bladder cancer and esophageal cancer tissues, only part of the sample cells visible light yellow particles in the cytoplasm. hWAPL gene in cervical cancer group immune integral (x ± s, 6.49 ± 2.54) was significantly higher than in CIN Ⅲ group (4.89 ± 1.67), P <0.001. CIN Ⅲ group immune integral significantly higher than CIN Ⅰ group (2.45 ± 1.06) and CIN Ⅱ (2.20 ± 1.19), groups, P less than 0.001. CIN Ⅰ group and CIN Ⅱ group immune integral difference was not significant, P = 0.553. CIN Ⅰ group immune integral was significantly higher than in normal cervix group (0.52 ± 0.70) (P <0.001). Normal cervix, CIN I, of CIN Ⅱ, CIN Ⅲ gene and cervical cancer hWAPL of positive expression rate has gradually increased, respectively, 3.70%, 40.00%, 42.42%, 89.47% and 97.87%, respectively. Cervical cancer and normal cervix, CIN I, CIN II positive expression rate was significantly different (x ~ 2 = 87.531, p <0.001). gene in gastric cancer, liver cancer, endometrial cancer, kidney cancer, colorectal cancer, lung cancer hWAPL negative expression; positive expression in bladder cancer and esophageal cancer, only a portion of the sample, 11.54% and 14.28% positive expression rate is divided into ; cervical cancer positive expression rate is as high as 97.87%. The second part hWAPL gene mRNA expression analysis Materials and Methods 8 cases of normal cervical and 11 fresh cases of cervical cancer tissue mRNA expression by real-time quantitative PCR. Β-actin gene as internal reference. β-actin primer sequences 5'ATCATGTTTGAGACCTTCAACA3 ', and 5'CATCTCTTGCTCGAAGTCCA3'. HWAPL gene primer 5'AATTGTCGAGCACTGATAGAG3 ', and 5'TTAAGTCAGCCTCAAGTACCC3'. The reaction conditions were 94 ° C, 2min, denaturation; 94 ℃, 30s, degeneration; 58 ° C, 30s, renaturation; 72 ℃, 40s, extends; total of 35 cycles. Each sample was done two parallel, and has two blank control. After the reaction was complete, the the PCR cycler computer automatically draw a standard curve obtained samples of all records point curve given Ct value amplification curve and the target gene copy number. Number of sample hWAPL gene mRNA copies / internal reference gene mRNA of β-action copy number = hWAPL the gene mRNA relative quantification. Experimental data using SPSS10.0 statistical software for analysis. Between two groups hWAPL genes relative expression level of comparison using t-test inspection level α = 0.05. Results normal cervix group hWAPL gene relative expression level was 1.81 ± 0.58 (x ± s), cervical cancer the group hWAPL gene relative expression to 11.16 ± 1.097. The significant difference between the two groups hWAPL gene mRNA expression levels exist (T = 21.838, P <0.001). The genes of conclusions hWAPL cervical cancer-specific high expression of the gene; With the the deepening of cervical intraepithelial neoplasia (CIN), hWAPL higher amount of gene expression; the cervical tissue hWAPL gene mRNA was highly expressed.
|