Dissertation > Excellent graduate degree dissertation topics show

The Reconstruction of Ascaris Allergen and Study on Etiology in Allergic Rhinitis

Author: YuChaoSheng
Tutor: WenZhong；TaoAiLin
School: Southern Medical University,
Course: Otorhinolaryngology
Keywords: Roundworms Allergen ABA-1 Codon Optimization Allergic rhinitis
CLC: R765.21
Type: Master's thesis
Year: 2011
Downloads: 24
Quote: 0
Read: Download Dissertation

Abstract

Roundworms are common parasites of the human body, the human roundworm infection can cause many diseases, including allergic diseases is one of the common diseases, Ascaris allergens by secreting sensitized body directly caused by the roundworm allergic disease. Ascaris allergen, ABA-1 protein (Ascaris the body fluid allergen) is an important allergen, it is a general term for protein composed of two types of A and B proteins, including Class A protein A4 A3, A2, A1 four kinds of composition, while class B protein B1 one kind. Roundworm treatment of allergic diseases, desensitization therapy is considered of a etiology effective method of treatment, desensitization therapy require desensitizing preparations have a higher purity and integrity of the epitope, in the domestic Ascaris allergen for many studies major roundworm crude extracts, which increases the risk of desensitization therapy, ABA-1A1 main protein in the ABA-1 protein in the foreign studies major, while neglected the role of the other proteins; the other hand, Ascaris can also by the method of immune regulation, changing the direction of the body's immune balance, so that the body is more susceptible to allergic diseases. The roundworm infection with the human, in part to stimulate the body to produce roundworm antibody, a large number of studies have shown that there is some connection between asthma and roundworm antibody, belong to the same airway allergic rhinitis and asthma, the same disease, Ascaris antibody with allergic rhinitis The study of the relationship between the less reported. To this end, in order to solve the problem of protein purity and integrity of the antigen epitope, as well as to investigate the relationship between the Ascaris antibodies and allergic rhinitis, we performed this experiment, trying to get Ascaris allergens fusion protein of high purity and the complete epitope , roundworms and preliminary description of the relationship between the antibody and allergic rhinitis; same time, we cloned the major protein in the expression of the ABA-1 protein in the ABA-1A1 and lay the foundation for immunological and functional studies of the fusion protein and monomeric protein. Chapter Ascaris allergen ABA-1 fusion gene and identification of a purpose of the reorganization and optimization of Ascaris allergen ABA-1 gene, E. coli expression system roundworm major allergen ABA-1 fusion protein purification and identification purposes fusion protein for the immunotherapy, mechanism of action and clinical diagnostic material basis. Second, the method to obtain the roundworm major allergen ABA-1 gene and protein sequences from Gene Bank (AF051702) and Protein database (Q06811), according to the ABA-1B1, ABA-1A4, ABA-1A3, ABA-1A2 and ABA-1A1, the differences between the kinds of protein amino acid sequence, select the differences larger ABA-IB1 restructuring of ABA-1A2 and ABA-1A1 gene, named the BAA and the new fusion gene size of 1200 bp; according to E. coli codon preference and amino acid codon mergers principle, does not change the amino acid sequence based on the gene to optimize the design, optimized gene is more conducive to the translation in E. coli; utilize] (?) NAStar software The fusion gene of RNA folding structure prediction, adjusting the partial amino acid codons, make RNA more conducive to the expression. After optimum design fusion gene BAA send synthetic Construction of synthetic genes BAA in PET-44A, the expression vector, the recombinant plasmid was designated as pET-44A-BAA, and then cloned into E. coli JM109 transformed by KCM method, Amp resistant screened, extracted plasmid PET-44a-BAA, after Nde Ⅰ and Pst I double digestion and DNA sequencing, was transformed into E. coli RosettaBlueTM extracted after Amp resistance screened PET-44a-BAA plasmid after Nde Ⅰ and Pst Ⅰ ??digestion and DNA sequencing, 37 ° C air bath, IPTG induction of expression, the new expression of proteins named the fusion protein BAA, take 1.5 mL 10000 rpm centrifuge for 1 min cells were harvested using 12% by SDS-PAGE the target protein expression; BAA microbial cells of the fusion protein after sonication, and 12% SDS-PAGE gel judged mainly exists in the supernatant or inclusion bodies, and using a Ni-NTA affinity chromatography purified; fusion protein BAA by Western Blot and amino acid sequencing identified allergenic and is a target protein. Results 1 to construct the expression plasmid PET-44a-BAA E. coli JM109 and E. coli RosettaBlueTM PET-44a plasmid by Nde Ⅰ and Pst Ⅰ ??double digestion, a specific band, with the target band visible at 1200 bp match the size; Blast analysis by DNA sequencing, and the target gene, the PET-44A, the inserted gene sequence and the desired gene sequence homology reaches 100%. This suggests that PET-44a-BAA plasmid was successfully constructed. 2, expression and purification of the fusion protein the BAA success in E. coli RosettaBlueTM induced expression of fusion protein in the BAA inducing conditions of 37 ° C air bath 200rpm shaking culture for 100 min,, to broth OD value between 0.6-0.7 by adding IPTG concentration of 0.5 mmol / L, and induced expression of 3 h, 12% by SDS-PAGE, a specific target band visible in the 45 kD, and its expression level by the coarse measured about 40% of the total protein. By sonication 12% by SDS-PAGE, and found that the fusion protein BAA is mainly present in the supernatant; supernatant protein was purified by Ni affinity chromatography, but in accordance with the non-denaturing conditions (buffer No 6 mol / L urea purification results), failed to get ideal purification results in 6 mol / L urea denaturing conditions, the purified protein purity of about 90%. 3, the identification of the target protein the BAA fusion protein BAA allergy serum with roundworm immunodetection found 45 KD at the visible bands of a specific purpose, and results show that the N-terminal 15 amino acid by amino acid sequencing, TMEHYLKTYLSWLTE, after BLAST analysis prove the protein fusion proteins for the purpose of the BAA. 4, successfully optimized fusion gene BAA correct description, by the identification of fusion genes the BAA and fusion protein BAA the fusion gene BAA has been successful optimization. Conclusion Ascaris allergen gene ABA-1 reorganization optimization, reorganization optimized gene BAA efficient expression in E. coli, BAA on the fusion protein can get high purity Ni affinity chromatography identified fusion protein as the target protein. Chapter II roundworm allergy original expression of the ABA-1A1 and identification of a purpose using PCR cloning Ascaris allergen ABA-1A1 gene construct pET-44a-ABA-1Al expression vector using the E. coli expression system Ascaris ABA-1A1 protein lay the foundation for immunogenicity and antigenicity of the fusion protein BAA to provide the material basis for the Ascaris allergen allergic transformation. Designed PCR primers A1F: 5'CAGCACATACCTCTCGTCGCG3 A1R: 5'AGAGGTATGCACACCATAGATCTTC3 'ABA-1A1 from fusion gene BAA transcription gene by PCR using the TA cloning technology is built on pEASY2-T3 carrier, blue-white screening, colony PCR and DNA sequencing, plasmid pEASY2-T3-ABA-1A1 digested Nde Ⅰ and Pst Ⅰ, the ABA-1A1 gene construct in the expression vector PET-44a, by the the KCM law transformed into E. coli JM109 in the cloning of PET-44a-ABA-1A1 by Nde Ⅰ and Pst I restriction enzyme digestion and DNA sequencing, was transformed into E. coli RosettaBlueTM IPTG induction after identification of the correct 12% SDS-PAGE detected the expression of results take ABA-1A1 cells were sonicated supernatant and pellet respectively 12% SDS-PAGE detected by Western Blot Identification of target protein;; ABA-1A1 protein was purified by Ni affinity chromatography. Results 1 to construct the expression plasmid PET-44a-ABA-1A1 E. coli JM109 and E. coli RosettaBlueTM in PET-44a plasmid identified by the Nde Ⅰ and PstI digested at 400bp seen a specific band, with the purpose of Article with size consistent with the target gene; confirmed by DNA sequencing, the Blast comparison analysis of PET-44a inserted gene sequence of the target gene sequence homology of 100%. This suggests that PET-44a-ABA-1A1 plasmid was successfully constructed. 2, expression and purification of ABA-1A1 successful, fusion protein in E. coli RosettaBlueTM induced expression of the protein in ABA-1A1 induction condition is 37 ° C air bath 200 rpm for 100 min, shaking culture, to broth OD value in the 0.6-0.7 between adding IPTG, the concentration of 0.5 mmol / L, induced expression 3h, 12% SDS-PAGE identification, a specific purpose of the strip is visible at 15 kD. By sonication 12% SDS-PAGE identified and found that the fusion protein ABA-1A1 is mainly present in the supernatant; supernatant protein by Ni affinity chromatography, to obtain a higher purity of the ABA-1A1 protein. 3, the identification of the target protein BAA protein ABA-1A1 with roundworm allergy serum by immuno-blot detection found 15 KD at the visible bands of a specific purpose, to prove that the protein is the target proteins ABA-1A1. Conclusion ABA-1A1 in E. coli efficient expression, which is compared with the immunological activity of the fusion protein BAA, roundworm desensitization vaccine development and allergenic transformation laid the foundation. Chapter Ascaris allergen fusion protein in allergic rhinitis pathogenesis role Objective To investigate the link between allergic rhinitis and Ascaris antibody, the method to collect the serum of patients with allergic rhinitis and healthy people, with the fusion protein BAA as antigen Wetern Blot method to detect the number of to contain roundworm allergen antibodies in patients with allergic rhinitis, and compare health the human roundworm antibody positive number, to explore possible links between Ascaris infection and the incidence of allergic rhinitis. Results in 32 patients with allergic rhinitis, 10 patients with Ascaris allergen antibodies, antibody-positive rate was 31.25%, 2 personal roundworm antibodies in 26 healthy controls, the roundworm antibody positive rate was 7.69%, compare antibody positive rate of allergic rhinitis and healthy human roundworm X2 test P lt; 0.05, significant differences between the two. Conclusion roundworm antibody with allergic rhinitis may have a certain relationship, there may be a potential risk factor for. The full text of conclusions using E. coli codon bias tropism characteristics, to optimize the design of the fusion gene BAA efficient expression in E. coli, and high purity epitopes fusion protein of the BAA; using the PCR method can be Ascaris allergen ABA-1A1 gene in smooth expression, purification and identification of the A1 protein with the immunological fusion protein BAA and function to lay the foundation; fusion protein BAA as an antigen by Western Blot survey found that roundworm infection may be closely related with the incidence of allergic rhinitis, may be a risk factor for allergic rhinitis.

Related Dissertations

CLC: > Medicine, health > Otorhinolaryngology > Rhinology,nasal disease > Nasal disease > Rhinitis
© 2012 www.DissertationTopic.Net Mobile