Dissertation > Excellent graduate degree dissertation topics show
Functional Analysis of GCC-box、D-box、JERE-box and JEGC-box in Rice
Author: HuangDingQuan
Tutor: HeShuiLin
School: Fujian Agriculture and Forestry University
Course: Developmental Biology
Keywords: synthetic promoter inducible promoter abiotic stress biotic stress GCC-box JERE-box JEGC-box D-box histochemical staining
CLC: S511
Type: Master's thesis
Year: 2010
Downloads: 28
Quote: 0
Read: Download Dissertation
Abstract
|
In nature,plants are continually challenged by fungi bacteria viruses and nematodes,which are a significant and growing threat to crop production worldwide.a major focus in plant science is the production of crops with increased and durable resistance to a spectrum of disease.in the past,durable resistance to disease has been sought by traditional marker-assisted breeding approaches or by the widespread application of pesticides,both approaches have proved ephemeral.because pathogen can overcome disease resistance gene or become resistant to pesticide and chemical control is economically costly as well as environmentally undesirable.as considerable insight into the molecular basis of plant -pathogen interaction and disease defense in plant. recently a new avenue are being pursued;transgenic approaches using tightly-regulated transgenes.However,attempts at pursuing resistant to fungal and bacterial disease by the introduction of transgenes has generally been unsuccessful.often failure were not because of the nature of transgene itself but rather the way in which it was expressed.A common strategy has been to constitutive overexpress a single component of the plant defense response using cauliflower mosaic virus(CaMV)35S promoter、rice actin promoter or maize polyubiquitin promoter.which improved disease resistance and acclimation to adverse environment but constitutive expression of resistance gene is not only wast of energy,in many cases likely to cause negative effects in plants such as display abnormal in growth、size、morphology、developmental timing、seed production or they show disease symptoms in the absence of pathogens,but also increases the selection pressure for more virulenct pathogens.Then a tentative plan came to our brain,it is possible for us to express the transgenes only when and where they are needed-at the infection site.This will limit the cost of resistance by restricting induced defence response to the infection site.Recent advances in synthetic promoter technology are enabling the production of novel promoters that direct tighter regulation of the transgenes. Pathogen-inducible promoters represent an attractive system for the production of synthetic promoters.there are a large number of known pathogen-inducible genes,and their promoters are among the best studied in plants.In this research, we employed the ethylene responsive element(ERE or GCC box),AGCCGCC,often present in the promoter reigons of ethylene regulated and pathogenesis related genes. a similar element has been reported to direct jasmonate and elicitor responsive expression(JERE box),AGACCGCC.the box D (TACAATTCAAACATTGTTCAAACAAGGAACC) from the parsley PR2 gene’s promoter approximately in -76 to -52bp region,but the extent of the element was unclear.and a combinational element containing GCC box and JERE box termed JEGC box in this thesis. using two copy of these elements placed upstream of the -46 35S minimal promoter of cauliflower mosaic virus to construct a novel pathogen-inducible promoter and fused with theβ-Glucuronidase gene (gus).These vector were introduced into rice cultivar(Oryza sativa L.ssp japonica) using Agrobacterium mediated method.which T1 seedling or calli were challenged with biotic、biotic stress' dissertation">abiotic stresses and exogenous hormone,such as Magnaporthe grisea、Cnaphalocrocis medialis、mechanical wounding、freeze、heat、high salinity、drought、ultraviolet radiation、heavy metal、abscisic acid、ethephon、salicylic acid analog and methyl jasmonate.which were analysed for GUS expression by histochemical GUS staining.The analysis of those result shows these novel pathogen-inducible promoter can direct infect-site expression transiently and confer plants with a durable resistance ,also with a very low level background expression under normal conditions.
|
Related Dissertations
- The Combined Effect of Several Environmental Factor on Fertilization, Hatching and Juvenile Growth of Nile Tilapia,S917.4
- Based on statistics of the lognormal distribution heteroscedasticity model inferred,O212.1
- The Effects of Overexpression of OsSsr1 on Stress Tolerance in Tobacco,S572
- A Smoothing Method for Solving Model under WCVarR,O224
- Expressive Characterization of Transcription Factors in Cotton Fibre Initiation and Cloning and Characterization of Three Transcription Factor Genes in Gossypium Hirsutum L.,Q943
- Preliminary Function Analysis of Two Annexins in Cotton (Gossypium Hirsutum L.),S562
- Study on Tetraploid of Chrysanthemum Nankingense Induction in Vitro and Its Breeding Utilization,S636.9
- Functional Analysis of MdCBF1 in Malus Domestica Borkh. CV. Fuji,S661.1
- Research and Implementation on HD and Interactive Display System Based on Digital TV,TN949.197
- Cloning and Characterization of Five Zinc-finger Proteins (ZFPs) Related with Stresses in Cotton (Gossypium Hirsutum L.),S562
- CBA Taiyuan stadium box office Marketing Strategy Research,G841
- The Construction Monitoring and Deformation Control and Analysis of the Box Culvert Jacking of the YouQuan Road Through the Hukun Railway,U449.5
- The Large Concrete Hydration Heat Temperature Effects Research of the Cable Stayed Bridge,U441.5
- The Arabidopsis STAR2 gene function analysis,Q943
- The Influence of Poly ADP-ribose Polymerase 1 (PARP-1) on HMGB1 Localization and Secretion in RAW264.7 Cell,R576
- Box foundation on sand ground reaction force base Study,TU471.16
- Study on the Project of Kanban Management in Thermofisher,F416.4
- Cloning and Expression Analysis of AP3-like Gene in Oncidium,S682.31
- Data mining technology in the Expo traffic with social media Prediction Research and Application,TP311.13
- CT images of concrete based on VTK visualization technology Research and Implementation,TP391.41
- The effectiveness of continuous competition reactor optimization approach and its application,TQ015
CLC: > Agricultural Sciences > Crop > Cereal crops > Rice
© 2012 www.DissertationTopic.Net Mobile
|