Dissertation > Excellent graduate degree dissertation topics show
The Rapid Inhibition of Progesterone on Peripheral Pain Signal Transduction Mediated by P2X3 Receptor
Author: FanJuan
Tutor: MaZuo
School: Second Military Medical University
Course: Physiology
Keywords: Progesterone P2X receptors ATP whole-cell patch clamp recording pain
CLC: R402
Type: Master's thesis
Year: 2009
Downloads: 60
Quote: 0
Read: Download Dissertation
Abstract
|
Pain is a typical sensory experience that may be described as an unpleasant sensory and emotional experience associated with actual or potential tissue damage. Pain is part of the body’s defense system, triggering a reflex reaction to retract from a painful stimulus, and helps adjust behavior to increase avoidance of that particular harmful situation in the future. It is a major symptom in many medical conditions, significantly interfering with a person’s quality of life and general functioning. Further, it may also become intractable and develop into a condition called chronic pain, in which pain is no longer considered a symptom but an illness by itself. Given its significance, scientific and clinical studies are carried out to find the effctive ways in pain relief.A number of chronic pain conditions such as irritable bowel syndrome, interstitial cystitis and orofacial pain are more prevalent in females than in males and the severity of pain fluctuates with the menstrual cycle, suggesting that gonadal hormones may affect the perception of painful stimulations. Sex-related differences in nociceptive responses have also been reported in rodents with females having stronger nociceptive reactions than males. However, conflicting results have been reported regarding the role of gonadal steroid hormones.Progesterone is primarily produced in the genital system. It keeps gynaeic physiological cycle and characteristics with estrogen. However, more and more investigations have shown that progesterone can be synthesized and secreted in the nervous system, and thus have functions as a kind of vital neurotransmitter. In the past a few of years, clinical, epidemiology and laboratory studies all report that gonadal hormones, not only estrogen but also progesterone, are proposed to account for sex-related differences in nociceptive responses.Progesterone is a kind of steroids with liposolubility. Progesterone classic receptors, consisting of two subtypes (ie, PRAand PRB), are widely distributed throughout the central and peripheral nervous systems. It has been demonstrated that progesterone can act through genomic mechanisms by binding to the classic receptors, which include the target gene transcription and the synthesis of new proteins. The function requires the longer latency. In addition, non-genomic mechanisms of progesterone have been report as well. It has been demonstrated that the peripheral sensory neurons express both classic and membrane progesterone receptors. The membrane progesterone receptors have been then cloned as three types,α,βandγ, withβtype specifically expressed in nervous system, including cortex, hyperthalamus, pituitary, spinal cordand dorsal root ganglion. Therefore, progesterone can potentially alter the nociceptive process at the primary afferent level.ATP is not only a substance for applying energy, but also a transmitter in nervous system. It is implicated in peripheral sensory transduction of noxious stimuli by activating ATP-gated ion channels, namely P2X receptors. 1) ATP is released by tissue and cells after nociceptive stimulation. 2) Exogenous ATP elicits pain through activating P2X receptors. 3) P2X receptors are widely distributed in sensory endings and afferent sensory pathways. 4) In P2X2 and P2X3 knockout mice, threshold of inflamed somatic pain is lower than control mice, suggesting that ATP is an important mediator of inflamed pain. In physiological conditions, P2X3 receptors are specifically involved in the pain signal transduction. Recent results showed that in the inflamed conditions, ATP plays a vital role in modulating inflammatory and pathologic pain by affecting P2X3 receptors. Therefore, ATP and P2X3 receptors are the vital members in modulating peripheral pain signal transduction and transmission.In this report, we have investigated the possible effects of progesterone on ATP-mediated peripheral pain signal transduction by using animal pain threshold test, whole-cell patch-clamp recording, and RT-PCR. We aim to observe the effect of progesterone on the modulation of the function of homomeric P2X3 receptors, in order to elucidate the relevance of sex steroids in pain Perception.1.Material and Methods1.1 Animals:48 SD female rats were randomly divided into four groups: a saline group, a progesterone group, a RU38486 group and a progesterone+RU38486 group..1.2 Behavior experimentsThe mechanical pain thresholds were tested by using Von Frey Hair filaments (Autonomic Neuroscience Institute, UK). On the day of experimentation, rats were placed under a plexiglass dome and allowed to accumulate for at least 30 min before beginning behavioral experiments. For mechanical hyperalgesia studies, rat hind paw withdrawl (PW) threshold in response to stimulation of Von Frey filaments [1(0.0229 g)、2(0.494 g)、3(2.05 g)、4(4.01 g)、5(6 g)、6(8 g)、7(10.8 g)、8(12.2 g)、9(14.9 g)]to the lateral plantar surface of the tested paw until it withdrew. To study the effect of progesterone on the mechanical hyperalgesia, phosphate buffer saline, progesterone and RU38486 was injected subcutaneously into the hind-paw. Following the injection, rats were immediately put back under the plexiglass dome and the mechanical pain threshold was tested.1.3 The reverse transcription–polymerase chain reaction analysis(1)RNA isolation and complementary DNA synthesisTotal RNA was extracted using a RNeasy Mini Kit (QIAGEN; Clifton Hill, Australia). RNA purity was determined using a method of ultraviolet spectrophotometry at a wavelength of 260–280 nm. Twoμg of total RNA was reversely transcribed to complementary DNA in a 20μl reaction mixture containing 1×reverse transcriptase buffer (15 mmol MgCl2, 375 mmol KCl, 50 mmol DTT, 250 mmol Tris–HCl, pH 8.3), 10 mmol dNTP, 20 U RNase inhibitor, 200 U mol-MLV reverse transcriptase, and 50 ng of oligo(deoxythymidine)15 primer. The reaction time was at least 1 h at 42°C. The cDNA was stored at ?20°C until real-time reverse transcriptase-polymerase chain reaction (RT-PCR) was performed. All reagents, with the exception of the RNeasy Mini Kit, were from Promega Corp. (Madison, WI).(2)RT-PCRThe full cDNA sequences of rat mPRα, mPRβ, and mPRγwere from GenBank (accession nos. DQ027002, DQ088964, and DQ088965, respectively). The following primers were used for PCR amplification: mPRα, ctggaagccgtacatctatgc and gaagctgtaatgccagaactc; mPRβ, aagaaggccagccctgctggtac and tttgtggaggcaggggcatt; mPRγ, agttccgccactgcctgcat and ccggggcttctggagttcaa; The PCR solution consisted of 2.0μl diluted cDNA, 0.4μmol of each paired primers, 2.5 mmol Mg2+, 250μmol deoxynucleotide triphosphates, 2 U Taq DNA polymerase (Promega), and 1×PCR buffer. The PCR conditions were 95°C for 3 min followed by 35 cycles of 95°C for 10 sec, 62°C for 10 sec, and 72°C for 10 sec. Fluorescence was measured after each cycle and displayed graphically (iCycler iQ Real-time Detection System Software, version 2.3; Bio-Rad). At the end of the PCR, samples were kept at 72°C for 10 min for the final extension and then stored at 4°C. Amplification products were separated by electrophoresis (1.5% agarose gel) and visualized by ethidium bromide staining using a 100-bp DNA ladder (Invitrogen) to estimate the band sizes. The lengths of the PCR products for Pmr , Pmr?, and Pmr mRNAwere 289, 379, 440 bp, respectively, as reported.1.4 Whole-cell patch clamp recording(1) Whole-cell voltage-clamp recording Whole-cell currents were recorded at room temperature using an Axopatch 200B amplifier with membrane potential being held at -60 mV. External solution contained (in mmol): NaCl 154, KCl 4.7, MgCl2 1.2, CaCl2 2.5, Hepes 10 and glucose 5.6 with pH adjusted to 7.4 using NaOH. Recording electrodes (resistance 2-5 MΩ) were filled with internal solution which contained (in mmol): KCl 120, HEPES 10, tripotassium citrate 10, EGTA 10, with the pH adjusted to 7.2 using KOH. Current signals were acquired using pClamp software and were plotted using Origin7.(2) Drug applicationDrugs were applied rapidly through a comprising 8 capillaries (ALA-VM8) made of fused silica coated with polyimide, with 250μm internal diameter, connected to a single outlet which was placed about 200μm from the cell. One barrel was used to apply drug-free solution to enable rapid termination of drug application. Solution exchange measured by changes in open tip current was complete in 200 ms. However, complete exchange of solution around an intact cell was considerably slower (1s). Agonists were separately applied for 2s at 4min intervals, a time which was sufficient for responses to be reproducible. Estradiol was present for 4 min before and during the reapplication of agonists.2.RESULTS2.1 Changes in the peripheral basal pain thresholdTo investigate the possible effects of progesterone on pain behavior, we carried out the behavior examination after systematic application of progesterone. In this experiment, mechanical pain thresholds were examined 30min and 60min after injection of progesterone, respectively. The mechanical pain threshold was significantly increased after 30 min application of progesterone compared with that in the control group, and then subsided until 60 min. To explore the mechanisms of progesterone-induced mechanical analgesia, a PR antagonist, RU38486 was given alone and together with progesterone respectively, the similar experiments were carried out 30min and 60min after injection. The data showed that RU38486 alone decreased the mechanical pain threshold and reversed the mechanical analgesia, induced by progesterone. 2.2 Identification of mPRα, mPRβand mPRγmRNA in cultured dorsal root ganglionRT-PCR results showed that mPRα,β,γmRNA was detected in rat dorsal root ganglion, with the length of 289, 379 and 440 bp.2.3 Rapid inhibition by progesterone of P2X3-induced currents in DRG neuronsThe effects of progesterone on the ATP-induced currents were studied on dorsal root ganglion (DRG) neurons by using whole-cell recording technique. Three types of currents (transient, sustained or biphasic) were evoked by ATP in cultured DRG neurons. When neurons were pre-incubated with progesterone (10 pmol/L-1μmol/L) for 4 min, an inhibition of the transient current and the transient component of the biphasic current were observed. In contrast, progesterone did not have any significant effect on the sustained current evoked by ATP. The inhibitory effects were concentration-dependent, reversible and could be blocked by the progesterone receptor inhibitor, RU38486. Actidione, an inhibitor of protein synthesis did not change the rapid effect. Cholesterol, a precursor of progesterone did not mimic the rapid depressive effect.2.4 Investigations on the signaling pathways of progesterone showed that non-selective antagonist of protein kinase, H-9 totally blocked the depressive effect of progesterone on ATP-current in a dose-dependent manner. The antagonist of protein kinase are related to the down-regulation of progesterone effect on P2X3 receptors in DRG.2.5 Blocking protein kinase A with KT5720 also affected progesterone-induced depression. PKA agonist Forskolin could mimic progesterone response. The cAMP-PKA signaling pathways are related to the down-regulation of progesterone effect on P2X3 receptors in DRG.2.6 Blocking PLC activity with U73122 prevented progesterone-induced depression. Application of inositol-1,4,5-triphosphate receptor (IP3R) antagonist, LY294,002 or protein kinase C inhibitors G?6976 partly blocked progesterone-induced depression of ATP currents. PKC agonist PMA could mimic progesterone response . The PLC-IP3-PKC signaling pathways are related to the down-regulation of progesterone effect on P2X3 receptors in DRG.2.7 Application of the complexes of protein kinase A inhibitors KT5720 and protein kinase C inhibitors G?6976 completely blocked progesterone-induced depression of ATP currents. The cAMP-PKA and PLC-IP3-PKC signaling pathways signaling pathways are related to the down-regulation of progesterone effect on P2X3 receptors in DRG. 3.CONCLUSIONS(1). The behavior results in this study also showed that mechanical analgesia appeared within 30min after injection of progesterone, and subsided after 60min, which could be reversed by co-applying of RU38486, an antagonist of progesterone receptors. These results can be explained by the progesterone acting on a non-genomic receptor.(2). RT-PCR results showed that mPRα,β,γmRNA was detected in rat dorsal root ganglion, suggesting that progesterone can potentially alter the nociceptive process in DRG neurons by non-genomic mechanisms.(3). In the cultured DRG neurons, progesterone could rapidly inhibited P2X3 receptor induced transient current and the transient component of biphasic currents by affecting PR and through activating cAMP-PKA and PLC-IP3-PKC pathways. The results suggest that progesterone specifically inhibits P2X3 receptors function in the peripheral sensory transmission. Therefore, progesterone might participate in control of the primary pain signal transduction by modulating P2X3 receptors in DRG through non-genomic mechanisms. The inhibitory effect of progesterone could involve the intracellular cAMP-PKA and PLC-IP3-PKC pathways. This study further supports the view that progesterone inhibits pain perception. More importantly, it elucidates for the first time that progesterone acts in the priamray sensory transduction level.
|
Related Dissertations
- The Treatment Effect and Mechanism of Ketanserin on Inflammatory and Neuropathic Pain,R741
- Over-voltage Identification of Transmission Line Based on Hilbert-Huang Transformation,TM866
- Effects of Kisspeptin-10 on Progesterone Secretion of Chicken Ovary Granulosa Cells and Mechanism Research,S831
- Development of the Colloidal Gold Immuno-Chromatographyic Strips for the Early Pregnancy Diagnosis of Hu Sheep,S858.26
- Application Study of Urethral Catheterization Patient by Using Lidocaine Hydrochride after Hemorrhoid Operation with Urinary Retention,R472
- Pharmacokinetics of Progesterone Cream in Beagle Dogs Determined with LC-MS/MS,R96
- The Correlation of Ultrasound Elasticity with the Expressions of Estrogen Receptor, Progestron Receptor, C-erbB-2 in Breast Cancer,R445.1
- Differential Diagnosis Significance in Patients with Chest Tightness Chest Pain and Analysis for the Risk Factors of Airflow Limitation,R54
- Experimental Study on Rat Sciatic Nerve Defect Repaired with Acellular Allograft Combined with Extracellular ATP,R651.3
- Expressions of HOXA9 HOXA10 and HOXA11 in Breast Cancer,R737.9
- The Research of Treatment Options and Prognosis’s Significance of Urinary ATP Quantification and Urodynamic Testing in Patients with BPH and OAB,R697.3
- Bao Tai Ling Oblatum for Early Threatening Abortion 40 Cases Clinical Curative Effects,R714.21
- The Roles of Spinal Cord Glia in Bee Venom-induced Nociception and Inflammation in Concious Rats,R741
- Cold stress and cold adaptation in rat heart and brain swimming ATP enzyme , calcium ions and free radical metabolism,R87
- Patients with chronic non-specific low back pain when trunk flexion and extension isokinetic muscle strength characteristics of,R87
- Application IP-RP-HPLC method study of creatine phosphate in mice pharmacokinetics and metabolic disposition,R96
- Cefotaxime on intracellular calcium ion transmembrane BEHAVIORS,R96
- Clinical Observation on Extracorporeal Shock Wave for Treating the Pain Symptom of ⅢB Prostatitis,R697.33
- Effect of IVM on rP2x4 Channel Deactivation,Q25
- The Mechanism of Lethal Effect of High-dose Vitamin C on Renal Cancer Cells,R737.11
- The Clinical Application of the Cropreservation of All Embryos in the Cycles of Oocyte Retrival,R714.8
CLC: > Medicine, health > Clinical
© 2012 www.DissertationTopic.Net Mobile
|