|
Objective: Lymphocyte antigen receptor allelic exclusion is also known as the monoallelic expression, only one of the two antigen receptor alleles from paternal side and maternal side shows activity in mature lymphocytes. Monoallelic expression of B lymphocyte antigen receptor (BCR) is through silencing one of two antigen receptor alleles. If there were no allelic exclusion, the same B cell would produce two different heavy chains and four different light chains (two kapa, two lambta). Presuming that the various heavy and light chains will associate with one another in an independent fashion, 30 different hetero-tetramers are possible, the majority of which will contain two different antigen binding domains. Allelic exclusion ensures the expression of effective multivalent antibody molecule, and that one B cell only produces a sort of BCR. Allelic exclusion appears to be a common epigenetic phenomenon, for example, allelic exclusion of olfactory receptor ensures the accuracy of olfactory identification, as well as X chromosome inactivation ensures an environmental balance of genes, all these phenomena play important biological roles. Over 60 years ago, these phenomena were observed. Since then, these phenomena have been the active research subjects, but their mechanisms can still not be identified.For decades, most studies focus on protein-coding genes and proteins. With the completion of human and mouse genome sequencing programs and the accumulation of regulation data of multi-cellular eukaryotic gene expression, research interest has shifted to non-coding sequences (including repeats). Non-coding DNA contains significant genetic informations of biological development and physiology. Protein’s role in allelic exclusion has been reported, and these proteins involve NFκB transcription complex and other transcription factors and can promot gene expression when the transcription factors bind the binding sites of promoter. However, other genes also use these transcription factors which are not T, B-cell-specific, and obviously there are other links. Typical genes undergoing allelic exclusion (VH, Vκ, Vλ, TCRα, TCRδ, TCRβ, TCRγ, olfactory receptors) are more inclined to distribute with homologous gene clusters, for example, the VH gene cluster contains about 100 VH tandem gene fragments, and 30% of human X chromosome is Line-1 repetitive sequences while only 15% of the other chromosomes is the Line-1. Bioinformatics analysis revealed that monoallele and its flanking contain more Line-1 repetitive sequences. These findings suggest that genomic characteristics of clustering of the same or similar sequences (i.e., clustered distribution of repetitive sequences) may be associated with allelic exclusion, and this is a scientific issue needed to be further verified by experiments, but up to now, the role of genomics characteristics of clustered distribution in allele exclusion is lack of research. According to genomics discoveries, all genes undergoing allelic exclusion have a tendency to own clustered distribution of repetitive sequences. Allelic exclusion of TCR, BCR, olfactory receptor and X chromosome inactivation may have the same foundation.Allelic exclusion of TCR, BCR and olfactory receptors shows not only in allele, but also in non-allelic homologous genes and in cis homologous genes. For example, genes of BCR’sκandλchains are not allele, but are exclusive, and more than 1000 olfactory receptors were located in a number of chromosomes in clustered distribution manner, but only one can express. Therefore, the process of allelic exclusion plays a role not only on alleles of homologous chromosomes, but also on isoformgene of non-homologous chromosomes and cis-arrangement isoformgene.Previously our work revealed that Line-1 and Alu repeats inhibited expression of GFP report gene when they were placed downstream of the gene, and SV40polyA sequence eliminated the inhibition induced by these repeats when it was inserted between GFP gene and the repetitive sequences. This raises the following questions: What sequence fragment in SV40PolyA can activate genes? Will the role of enhancer sequence be enhanced or weakened after the sequences are stringed together in a head and tail tandem manner? What sequence is the core sequence in enhancer sequence? With the increase of the copy number of silencing gene sequence, the effect on suppressing gene expression increased. What impact will it be with the increase of the copy number of activating gene sequence? It is helpful for understanding allelic exclusion using experiments to answer these questions.Methods: 1. Synthesis of primers and DNA fragments as templatesPrimers were designed and synthesized with suitable restriction enzymes sites, and DNA fragments were synthesized with different mutation sites as templates. Primers used for construction of expression vectors and labeled probes in Northern hybridization are shown in Table 1 and 4.2. Construction of expression vectorsUsing primers with suitable restriction enzyme sites,the polymerase chain reaction (PCR) was used to amplify desired fragments, and then the PCR products digested with suitable restriction enzymes were inserted into downstream of GFP gene in pAlu14, so that expression vectors were obtained. If cohesive terminals of XbaⅠand NheⅠrestriction enzymes were ligated by T4 DNA ligase, neither XbaⅠnor NheⅠcould digest the site again. Using the characteristics, tandem expression vectors were obtained.3. Cell culture and cell transfectionHeLa cells were routinely cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal calf serum, and transfected with plasmid DNA via the liposome technique (Lipofectamine 2000; Invitrogen, Grand Island, NY). Incubation was performed at 37℃,in 5% CO2 condition for 36h, in order to observe the expression of green fluorescence protein and to isolate total RNA for further study.4. Northern blottingThe GFP probe was labeled withα-32P-deoxycytidine triphosphate (dCTP) via 9nt random primers. Total RNA from the plasmid-transfected HeLa cells was extracted with Redzol reagent; The RNA was subjected to electrophoresis on a formaldehyde-denatured gel, transferred to nylon membranes. The nylon membranes containing RNA blots were treated with the GFP probe and autoradiography was performed, and then were treated twice with a solution of 50% formamide-5% SDS-50 mM Tris (pH 7.4) at 80℃for 1 hour and hybridized with aα-32P-labeled probe for neo (the cassette for neomycin resistance) RNA. The primers amplyfing for GFP and Neo templates are shown in table 1.Results: 1. Construction of recombinant vectorAlu14(14 head and tail tandem Alus), Alu18 and Alu28 were inserted into the multiple clone sites (MCS) of pEGFP-C1 to construct pAlu14, pAlu18 and pAlu28, respectively. On the bases of these recombinant plasmids, PolyA, PolyAas, 1F1R (the first 60bp segment at the 5’end of PolyAas), 2F2R, 3F3R(middle two segments, each 60bp), 4F4R(the fourth 60bp segment from the 5’end of PolyAas), tandem 2F2R and tandem 3F3R were inserted between GFP gene and Alus, respectively. Fig.1A shows the position and nucleotide sequences of PolyAas segments; Fig.1B denotes the site of inserted fragments; Fig.1C shows the process of construction of expression vector.2. Identification of recombinant vectorRecombinant vectors identified by PCR, sequencing and restriction enzyme digestion were proved to be correct sequences. The results of PCR identification are shown in Figure 2. The results of restriction analysis are shown in Figure 3. The sizes of PCR fragment and restriction fragment matched with the expected sizes. A part of sequencing results is shown in Figure 4 and Table 2. All sequences used for experiments are correct.3. PolyA and PolyAas sequences eliminate the inhibition of GFP gene induced by AlusInserting Alu14 into downstream of GFP gene in pEGFP-C1 vector decreased the level of GFP RNA (Fig.2, lane 3 vs. lane 5) significantly. Inserting PolyA in both the sense and antisense orientations between GFP gene and Alu14 decreased the inhibition of GFP gene caused by Alu14 (Fig. 2, lanes 1 and 2 vs. lane 3). It is clear that the PolyA sequences eliminate the inhibition of gene expression caused by Alus, and induce a much greater increase in the expression of GFP gene in the antisense than the sense orientation.4. The effects of distinct PolyAas segments on GFP gene transcriptionPolyAas had much stronger effect on gene activation than PolyA itself as shown in Fig.2. That was the reason why we studied the effects of PolyAas segments. We inserted four different segments (1F1R,2F2R,3F3R and 4F4R) between GFP gene and Alu14 in pAlu14, respectively. 1F1R and 4F4R can not activate GFP gene (Fig.6, lanes 1 and 4); whereas 2F2R and 3F3R can activate GFP gene (Fig.6, lanes 2 and 3 vs. lane 6, respectively). The findings indicated that 2F2R and 3F3R contained enhancer elements. In addition, 14, 18 and 28 Alu repeats(Alu14, Alu18 and Alu28)all repressed transcription of GFP gene intensively (Fig. 6, lanes 6, 7, 8 vs. lane 10).5. Suitable copy number of 2F2R or 3F3R segment plays key role in the process of activating GFP geneOne copy of 2F2R or 3F3R segment relieved the suppression of the GFP gene expression caused by Alus (Fig6). We wondered whether these two segments had stronger capacity for activating the expression of GFP gene when they were linked in a tandem manner.We inserted tandem 2F2R repeats and 3F3R repeats into downstream of GFP gene in pAlu14 plasmid, respectively. p2F2R*4-Alu28 (inserting 2F2R*4 into pAlu28, the size of the inserted sequence is 60bp*4+283bp*28=8164bp) was regarded as the control of p2F2R*64-Alu14 (the size of the inserted sequence is 60bp*64+283bp*14=7802bp). p3F3R*4-Alu18 (inserting 3F3R*4 into pAlu18,the size of the inserted sequence is 60bp*4+283bp*18=5334bp) was the control of p3F3R*32-Alu14 (the size of the inserted sequence is 60bp*32+283bp*14=5882bp) , and p3F3R*4-Alu28 was the control of p3F3R*64-Alu14.The amount of GFP transcript increased in cells transfected with p2F2R*1-Alu14, p2F2R*2-Alu14 and p2F2R*4-Alu14 (Fig.7A, lanes 1-3), and then decreased in cells containing p2F2R*8-Alu14, p2F2R*16-Alu14 and p2F2R*64-Alu14 (Fig.7A, lanes 4-6) in turn.The changing rule of GFP transcript level in 3F3R tandem expression vectors (lanes 1-7 of Fig.7B) was similar to that of 2F2R repeats in lanes 1-6 of Fig.7A. The amount of transcript increased in cells transfected with p3F3R*1-Alu14, p3F3R*2-Alu14 and p3F3R*4-Alu14 (Fig.7B, lanes 1-3), and then decreased in cells containing p3F3R*8-Alu14, p3F3R*16-Alu14, p3F3R*32-Alu14 and p3F3R*64-Alu14 (Fig.7B, lanes 4-7) in turn.DNA sequence analysis showed that the lengths of the inserted sequences in p2F2R*4-Alu28 (Fig.7A, lane 8) and p2F2R*64-Alu14 (Fig.7A, lane 6) were similar, but the amount of transcript of p2F2R*4-Alu28 was much more than that of p2F2R*64-Alu14. The length of the inserted segment in p3F3R*4-Alu18 (Fig.7B, line 9) was similar to that in p3F3R*32-Alu14 (Fig.7B, lane 6), yet the former plasmid had much more transcript than the latter. Furthermore, the amount of transcript of p3F3R*4-Alu18 was even more than that of p3F3R*16-Alu14 which had fewer base pairs of inserted sequences (Fig.7B, line 5). The amount of transcript of p3F3R*4-Alu28 (the inserted segment, 8164bp) (Fig7.B, lane10) was more than that of p3F3R*64-Alu14 (the inserted segment, 7802bp), p3F3R*32-Alu14 (the insert segment, 5882bp), and p3F3R*16-Alu14 (the inserted segment, 4922bp) (Fig.7B, lane 10 vs. lanes 5, 6, 7). These results suggested that the decreased amount of GFP transcript was not induced by the increased length of inserted sequence.Both 2F2R and 3F3R segments had similar characteristic in the process of affecting the level of gene expression. However, the length of transcript increased when more copies of 2F2R segment were placed in pAlu14 (Fig.7 A), which illustrated that 2F2R segment did not cause premature transcriptional termination. The lengths of transcripts were similar when different copies of 3F3R were placed in pAlu14 (Fig.7 B), which suggested that 3F3R caused premature termination.6. Effect on the expression of GFP protein induced by 2F2R or 3F3R tandem repeatsUsing a fluorescence microscope, we viewed the expression of GFP protein in HeLa cells transfected with expression vecrors, and found that the vectors containing 2F2R and 3F3R segments increased the expression level of GFP protein (Fig.8 A and B) as compared with pAlu14 (Fig.8 C). When one copy of 2F2R or 3F3R segment was inserted into pAlu14, the percentages of GFP positive cells reached to 4.7% and 36.4% from less than 1%, respectively (Tab. 3).It is interesting to note that decrease of the expression of GFP protein was found out when 32 or 64 copies of the 3F3R or 2F2R segment were placed in pAlu14 (Fig.8, Tab.3). To identify that decrease of the expression of GFP protein was not due to the increased length of inserted segment in expression vectors, we used p2F2R*4-Alu28, p3F3R*4-Alu18 and p3F3R*4-Alu28 as the length control. Table 2 and Fig.8 show that percentage of GFP positive cells containing p2F2R*4-Alu28 is higher than that of cells containing p2F2R*64-Alu14, meanwhile percentages of GFP positive cells containing p3F3R*4-Alu18 and p3F3R*4-Alu28 are higher than those of cells containing p3F3R*32-Alu14 and p3F3R*64-Alu14.In a word, suitable copy number of 2F2R or 3F3R segment induced the highest level of expression of GFP protein, which is consistent with the results of Northern blot (Fig.7).7. Analysis of 2F2R core sequenceWe inserted different fragment of 3F3R into pAlu14 and found 3F46 could activate gene. Single base-pair deletion was made by turns from 3F46 5 ’end. The Sequencing diagrams are shown in Figure 4,and the sequences are shown in Table 2. There was no significant effect on gene expression when 8bp was deleted,but the gene expression decreased significantly when 9bp or more was deleted, so we named the sequence 3F46d8 (deleting 8bp) as 3F38(ATAAACAAGTTAACAACAACAATTGCATTCATTTTATG). The results of Northern blot were shown in Figure 10. On the bases of 3F38, single base-pair deletion was made by turns from 3F38 3 ’end. The Sequencing diagrams are shown in Figure 4 and the sequences are shown in Table 2. Northern blot results showed that gene expression decreased significantly when 6bp or more was deleted (Figure 11).Conclusion: 1. SV40PolyA in either orientation eliminated the inhibition of GFP gene expression induced by Alu repeats. 4 different segments (each 60bp) were amplified from PolyAas by PCR, Our experiments certified that 1F1R (the first 60bp segment at the 5’end of PolyAas) and 4F4R (the fourth 60bp segment from the 5’end of PolyAas) did not activate GFP gene expression, whereas 2F2R and 3F3R (middle two segments) activated GFP gene expression.2. Two and four copies of 2F2R had strongest capability of activating GFP gene, and then with the increase of copy number the activating role declined in turn.3. Two copies of 3F3R had strongest capability in the process of activating GFP gene, and then with the increase of copy number the activating role declined in turn, the similar tendency with 2F2R.4. Analyzing the results of single base-pair deletion from 3F3R, we found that upstream 9bp to 41bp in 3F3R contained the core sequence of activating gene(5’-ATAAACAAGTTAACAACAACAATTGCATTCATT).
|