Dissertation > Excellent graduate degree dissertation topics show
Experimental Study for Expression of B7-1 and B7-2 in Cold Ischemia/reperfusion Injury of the Rat Liver
Author: LiRui
Tutor: LiuJun
School: Shandong University
Course: Surgery
Keywords: Costimulatory molecules Ischemia-reperfusion Liver transplant Rats
CLC: R657.3
Type: Master's thesis
Year: 2008
Downloads: 32
Quote: 0
Read: Download Dissertation
Abstract
|
Background liver transplantation is today the treatment of end-stage liver disease, the only effective method in the field of liver transplantation faces two major problems, that the donor liver ischemia-reperfusion injury and immune rejection. Liver cold ischemia-reperfusion injury in liver transplantation pathophysiological process, it exists in the liver was cut, save, as well as all aspects of transplant. Ischemia-reperfusion injury affect the function of the liver after transplantation, with more severe primary function is closely related to, and increase the probability of the occurrence of acute rejection. Prior to Kupffer cells and T lymphocyte infiltration in ischemia-reperfusion injury in the liver tissue of many reported, but about costimulatory molecule expression and its potential role in cold ischemia-reperfusion injury in liver tissue still has not been elucidated. The activation and proliferation of T cells is dependent on the double signal: When the T cell receptor (T cell receptor TCR) existing on the antigen-presenting cells (antigen presenting cell APC) in the surface of the major histocompatibility complex peptide complex was (major Histocompatibility Complex MHC) After the combination, the first signal is activated; the second signal is a costimulatory signal (co-that stimulation signal), when the combination of the surface of the T cell co-stimulatory molecule receptor with its ligand, the second signal is activated, and B7- 1 (CD80), B7-2 (CD86) that is present in the antigen presenting cell surface ligand. When only the first signal of the T cells, T is the incompetence of a specific state. CD28 is a common stimulus in the T cell surface molecule B7 receptor mediated stimulation of T cell proliferation, promote the secretion of cytokines, to maintain the status of T cell responses. In vivo or in vitro use of the cytotoxic T lymphocyte-associated antigen-4 fusion protein (cytotoxic Tlymphocyte-associated antigen 4-Ig, CTLA4-Ig) block bound to the CD28 and B7-1 (CD80) and / or B7-2 (CD86), will inhibit T cell activation, thereby suppressed allogeneic organ transplantation model of experimental acute or chronic rejection. From Takada and Chandraker A. study found that the T lymphocyte costimulatory pathways involved in renal ischemia-reperfusion injury, many sights costimulatory molecules in organ cold ischemia and reperfusion injury in rats. Harvesting, irrigation, save, blood flow and opening up a series of links in a liver transplant, the donor liver donor liver will be cold ischemia reperfusion Loss blow. The experiment from the immunological point to cold ischemia-reperfusion injury in rat liver study, using immunohistochemistry and semi-quantitative RT-PCR technology were detected B7-1 and B7-2 protein and B7-1 and B7-2mRNA expression to further investigate cold ischemia and reperfusion Contact with acute liver transplant rejection, and propose new prevention strategies to inhibit or reduce cold ischemia reperfusion related liver transplant early acute rejection. Literature on the investigation, not yet retrieved the expression of costimulatory molecules after cold ischemia and reperfusion liver transplant early acute rejection research papers or reports. 【Objective: To investigate the costimulatory molecules B7-1 and B7-2 in rat liver cold ischemia-reperfusion injury model in rats and its immunological significance. 【Methods: male Wistar rats 30, weighing 200-250 g, were purchased from Shandong University animal testing center. 30 rats were randomly divided into three groups: group A sham group (control group); B group cold ischemia reperfusion 24h 20min; group C cold ischemia reperfusion at 24h 30min. Animal model with reference to the method of Hu Jianping: Preoperative fasting for 12 hours, can not help but water, ether open inhalation anesthesia. B, C respectively with 4 ° C Ringer lactate infusion group A as normal control. Splenic vein and right adrenal vein as perfusate inflow and outflow tract be done in situ cold perfusion, cold ischemia time was 30min and 60min. Group B and group C, respectively reperfusion to 24h the liver tissue, A group abdomen was closed after 24h collected tissue samples of the left lobe of the liver. 3. Semi-quantitative reverse transcriptase polymerase chain reaction (RT-PCR): using the Trizol (Canada BBI) kit to extract total RNA from tissue samples, and β-actin protein (β-actin) for internal control, β-actin, B7-1 and B7-2 primer sequence reference Naosuke Kojima reported synthesis assisted by the Shandong Provincial Academy of Medical Sciences. upstream of the β-actin primers: 5'-ATGGARTCCTGTGGCATCCA-3 ', reverse primer: 5'-CGCTCAGGAGGAGCAATGAT-3, amplification products 224bp; the B7-upstream primer material to: 5'GGCATTGCTGTCCTGTGATTAC', downstream primer: 5 ' ACTCAGTTATGTTGGGGGTAGG 3 ', amplification product of 314bp; the B7-upstream primer material to: 5'GCTCGTAGTATTTTGGCAGGACC', downstream primer: 5'CGGGTATCCTTGCTTAGATGAGC 3 ', amplification product of 337bp. Two-step RT-PCR reaction to detect the expression of B7-1, B7-2 mRNA. 1% agarose gel electrophoresis, AlphaImager TM sup> 2200 gel imaging system observed electrophoretic bands stored image. System SPOT DENSITY software an internal reference, and B7-1, B7-2 gene amplification in the density of the strip, with B7-1, B7-2 strip density and the density of the reference housekeeping gene ratios represent gene expression were measured relative level of analysis for semi-quantitative amplification product. Immunohistochemistry: application of immunohistochemistry SABC method detected 30 cases of liver tissue B7-1, B7-2 protein expression, analysis of B7-1 and B7-2 protein expression of liver cold ischemia-reperfusion injury rejection relationship. 【Results】: 1.B7-1 mRNA expression in group B, C 0.529 ± 0.089 and 0.618 ± 0.074, compared with group A (0.131 ± 0.012) was significantly higher (P <0.01). In B7-2mRNA in group B, C group expressed as 0.474 ± ??0.132 and 0.682 ± 0.095, compared with group A (0.163 ± 0.054) was significantly higher (P <0.01). 2.B7-1, B7-2 mRNA expression levels between group B and group C, group B, a significant difference (P <0.05 and p <0.01) higher than in C group. 3.B7-1 protein expression in group B, C 170.600 ± 23.717 and 216.100 ± 24.740, compared with group A (127.800 ± 12.541) was significantly higher (P <0.01); B7-2 protein expression in group B, C 189.800 ± 19.971 and 239.000 ± 21.328, compared with group A (131.700 ± 22.969) was significantly higher (P <0.01). 4.B7-1, B7-2 protein expression levels between group B and group C, a significant difference (P <0.01) than in group B, group C. Conclusion: cold ischemia and reperfusion in rats liver costimulatory molecules B7-1 and B7-2 mRNA expression was significantly up-regulated; cold ischemia and reperfusion in rat liver immunogenicity due to B7-1 and B7 -2mRNA raised higher. Cold ischemic reperfusion in rat liver, liver sinusoidal endothelial cells through the expression of B7-1 (CD80) and B7-2 (CD86) play an important role in antigen-presenting cells. 3.B7-1 and B7-2 will be the inhibition of liver cold ischemia-reperfusion injury in the liver transplant new target for early rejection.
|
Related Dissertations
- Effects of CrPyr on Protein Metabolism in Rats,S865.12
- The Protective Effect of Rat Myocardial Ischemia/reperfusion Injury Following Bone Marrow Mesenchymal Stem Cell Pretransplantation for 1 Week,R542.22
- The Effects of Atorvastatin on Expression of Osteopontin in Kidney of the Diabetic Rats Its Molecular Mechanism,R587.2
- Effects of Partial Hepatic Ischemia/Reperfusion Injury on Postoperative Cognitive Function in Mice,R614
- Meridians of Asthma Thread Burying Model Rats IL-4 Such Impact Experimental Study,R245
- The Study of the Effects of Isoflavones of Puerarin and Daidzein on Bone Metabolism in Ovariectomized Female Rats,R580
- Effect of Microwave on GAP-43 Expression in the Spinal Cord after Sciatic Nerve Lesions in Rats,R651.3
- Expression and Significance of HIF-1α on the Insulin Resistance during the Injury of Reperfusion of Ischemic Myocardium in Dog Undergoing Cardiopulmonary Bypass,R654.1
- The Expression and Mechanism of NF-κ B and IL-6 after 90% Portal Vein Ligation in Rats,R657.3
- In Vitro Culture and Identification of Vascular Smooth Muscle Cells from Rat Intra- and Extracranial Arteries,R743.3
- Effects of Different Species Meats on Growth, Digestion Metabolism and Antioxidant Status in Rats,S865.12
- Effect of Grape Seed Procyanidins on the Blood Pressure in Renovascular Hypertensive Rats and Its Mechanism,R544.1
- The Research on Treatment of Lentivirus-mediated hVEGF-165 Gene Transferring Mesenchymal Stem Cells on Rat Hind Limb Ischemia,R329
- Experimental Study of Neural Stem Cells around the Lateral Ventricular Zone of the Hydrocephalus Rats,R742.7
- Effect of Nrf2-ARE Pathway on Isolated Rat Hearts Using Ischemia or Pinacidil Postconditioning,R96
- Anti-gout Capsules on the Treatment of Gouty Arthritis and Its Mechanism,R259
- Protective Effect of Huangqi Injection in Children’s Mechanical Ileus Ischemia-reperfusion Injury,R272
- Experimental Study of GUI QIN MISTURE on Adriamycin-induced Nephropathy in Rats,R285.5
- The Exploration of Aldehyde Dehydrogenase 2 in the Cardioprotection of Fasudil,R54
- Effects of Losartan on Na~+, K~+-ATPase in Proximal Tubules Epithelial Cells of Spontaneously Hypertensive Rats,R544.1
- The Influence of Cold Self-bloodcardioplegia to MMP-2 Concentration for Infant with Cardiopulmulnary Bypass,R726.5
CLC: > Medicine, health > Surgery > Of surgery > Abdominal surgery > Liver and liver tube
© 2012 www.DissertationTopic.Net Mobile
|