|
Background vivo overwhelming majority of protein present in the form of a glycoprotein. Located in the Golgi apparatus of the N-acetyl glucosamine transferase and play a key role in the synthesis of glycoproteins. There are at least six kinds of N-acetyl glucosamine transferase enzyme-V (N-acetylglucosaminyltransferase V, GnT-V), wherein the transfer of N-acetyl glucosamine is currently the most studied. Its main function is a multi-branched structure is formed on the basis of the core pentasaccharide the GlcNAc (Gn) in the glycosyltransferase to the pentasaccharide core of N-glycan, the donor substrate UDP-N-acetyl glucosamine (UDP-GlcNAc) two mannose, catalytic N-glycans-β1, 6 branch formation. GnT-V affects the mechanism of tumor malignant behavior, there are two: First, as a glycosyltransferase abnormal expression can cause cell glycoprotein β1, 6 branching structure abnormal glycosylation, which affect the proliferation of tumor cells metastasis and invasion capacity. The second is as Golgi enzyme can be secreted into the blood circulation, the secreted forms of GnT-V can cause tumor angiogenesis. Current studies in colon and breast cancer, the expression levels of GnT-V and the malignant biological behavior was positively correlated; GnT-V expression is lower in non-small cell lung cancer, however, the degree of malignancy instead higher. The above study showed that play different roles in different tumor cells, GnT-V. The high incidence of nasopharyngeal carcinoma in southern China, has seriously affected the quality of life of the people in the region of southern China. Impact nasopharyngeal malignant biological behavior of many factors, including EB virus infection, some change in the molecular structure, for example: Bmi-1 protein, matrix metalloproteinase -19. Approximately 30% -40% in advanced nasopharyngeal carcinoma patients with local recurrence and distant metastases. The nasopharyngeal divided into WHO Ⅰ, Ⅱ and Ⅲ, where 97% of the cases belong to the WHO Ⅲ type, radiation therapy is the main treatment for type III nasopharyngeal carcinoma. However, due to individual differences, not all of nasopharyngeal carcinoma cells sensitive to radiotherapy, of some nasopharyngeal carcinoma cell radiosensitivity, poor treatment. Have been found and nasopharyngeal carcinoma cell radiosensitivity predicted molecular Raf kinase inhibitor protein, GRP78 protein and p53 genes. But so far not yet a recognized symbol of molecules that can predict the radiosensitivity of nasopharyngeal carcinoma cells. Although many studies have shown that GnT-V, and a variety of tumor malignant behavior is closely related to, but there is no relationship between the reported nasopharyngeal carcinoma cells and GnT-V. In this experiment, we used RNA interference technology to down nasopharyngeal carcinoma cell line CNE-2 GnT-V expression levels, low expression of GnT-V cell line CNE-2 GnT-V/2224; by comparing nasopharyngeal nasopharyngeal carcinoma cell malignant behavior of cancer cells and low expression of GnT-V, GnT-V, and nasopharyngeal cancer cell proliferation, invasion and other biological characteristics of the relationship between. In addition, we also studied the GnT-V on the radiosensitivity of nasopharyngeal carcinoma cells and its possible internal mechanism was discussed. Research purposes using RNA interference technology to down nasopharyngeal carcinoma cell CNE-2 expression levels of GnT-V, observed GnT-V on proliferation, invasion, metastasis, and radiosensitivity of nasopharyngeal carcinoma new target for molecular targeted therapy is determined to provide an objective basis. Experimental methods pGPU6/GFP/Neo GnT-V shRNA plasmid and identified by the Task Force members to complete. the pGPU6/GFP/Neo GnT-V/1564 and pGPU6/GFP/Neo GnT-V/2224 targeting inhibition of GnT-V expression plasmid; pGPU6/GFP/Neo GnT-V/NC control plasmid. 2, cell culture and transfection of human nasopharyngeal carcinoma cell line CNE-2 at 37 ℃ 5? 2 conditions, were cultured in RPMI-1640 medium containing 10% fetal bovine serum, weekly passaged 2-3 times. Cells cultured to logarithmic phase liposomes Lipofectamine2000TM to plasmid was introduced into CNE-2 cells. G418 selection transfected cells of success. 3, pGPU6/GFP/Neo GnT-V shRNA interference effect detection a.qRT-PCR determination of GnT-V mRNA extracted using Trizol total RNA in exponentially growing cells, the experiment by real-time quantitative RT-PCR kit. The GnT-Ⅴ upstream primer for 5'GAGCAGATCCTGGACCTCAG 3 ', the downstream primer 5'GCTGTCATGACTCCAGCGTA 3'. β-actin as an internal reference, the upstream primer 5'GAAACTACCTTCAACTCCATC 3 'the downstream primer 5'CGAGGCCAGGATGGAGCCGCC 3'. CDNA was synthesized by the reaction conditions: 15 min 37 ° C, 5 seconds to 85 ° C. PCR reaction conditions: initial denaturation 95 ° C 30 seconds, PCR reaction 95 ° C 5s, 60 ° C 20S (40 cycles), melting curve analysis of 95 ° C for 0 sec, 65 ° C for 15 seconds, 95 ° C for 0 sec. Calculate the 2-ΔΔCt, representing each group relative mRNA expression levels. Each number of repeating Example 3. b.Western blot detecting the protein expression of the GnT-V to extract the total protein, and protein concentration was measured to draw the total protein, deionized water up to 20μL, adding sample buffer boiled for 5min, draw 25μL sample after centrifugation, by discontinuous SDS-PAGE electrophoresis After separation, the electricity of the semidry transfer to PVDF membranes, 7% skimmed milk powder 3% BSA at 37 ° C closed 2H TBST after washing the membrane with a sheep anti-human GnT-V protein polyclonal antibody (1:200), sheep anti-human GAPDH monoclonal antibody (1:1000) 4 ℃ incubated overnight, washing the membrane were added to the HRP-labeled rabbit anti-goat IgG (1:4000), IgG (1: 6000), room temperature with shaking 1h, the membrane was washed after ECL chemiluminescence detection, darkroom exposure x-ray film, processed film, UVI gel imaging system camera, Quantity One software analysis stripe gray value, the GnT-Ⅴ / GAPDH relative expression level on behalf of GnT-Ⅴ protein. Each group the number of repeat cases 4, CCK-8 detection down to take the logarithmic growth phase of the test cells CNE-2 cell proliferation after expression of GnT-Ⅴ CCK-8 OD450nm values ??measured at different time points (0h, 24h, 48h, 72h, 96h). Calculate the fraction of cell growth, the growth curve. Were divided into CNE-2, CNE-2 GnT-Ⅴ / NC group, CNE-2 GnT-Ⅴ / 2224 group, the number of cases for each set of duplicate 12.5, scratch healing assay lowered the expression of GnT-Ⅴ CNE-2 cell migration ability to take the logarithmic growth phase under test cells were seeded in 24-well plates, and culture to the growth state of the cells were adherent monolayer. 100ul pipet tip scratches, respectively, in each group of single-cell layer culture medium containing 10% FBS, culture was continued in order to make the scratch healing. Were scratches after 0h, 12h, 24h camera, the ability to observe the scratches heal, healing ability with a representative of the healing rate. Healing rate = [(healing before cell layer distance on both sides - both sides of the cell layer distance healing) / healing before both sides of the cell layer distance] × 100%. Were divided into group CNE-2, CNE-2 GnT-Ⅴ / NC group and CNE-2 GnT-Ⅴ / 2224 group, the number of cases for each set of duplicate 3.6 cell invasion assay cut expression of GnT-Ⅴ CNE -2 cell invasion ability to take the logarithmic growth phase cells incubated overnight with serum-free RPMI1640. By 24-well chemotaxis chamber and matrigel the glue detection cell invasiveness. The results are shown through matrigel gum and the number of cells of the polycarbonate film at the same time, randomly taken from five fields of view are counted under a microscope. Were divided into group CNE-2, CNE-2 GnT-Ⅴ / NC group and CNE-2 GnT-Ⅴ / 2224 group, the number of cases for each set of duplicate 15.7, heterogeneous adhesion assay lowered expression of GnT-Ⅴ CNE-2 of heterogeneous cell adhesion ability to Matrigel plastic imitation of the basement membrane heterogeneity adhesion assay, Matrigel 4 ° C overnight to melt, take a 96-well plate the decking of Matrigel 50μL / hole, gently shaking pave Marigel rubber, 37 ℃ 1Omin coagulation. Boiled for 13min denaturation, 10g / L BSA (1 × PBS preparation) added to each well 100 μL, 37 ° C closed 1H closed after washed 2 times with 1 × PBS. The tested cells were cultured until the logarithmic growth phase, with serum-free RPMI1640 culture overnight. The cells were collected, and adjust the cell number of 5 x 104 / well was added a cell suspension, and incubated at 5% CO2 37 ° C for 1H. Remove the 96-well plates, 1 × PBS rinse, each hole by adding 100μL RPMI1640 10μLCCK-8, 37 ℃, 5% CO2 culture 1h, measuring two groups OD450nm value. 96-well plates laid directly 10g / L BSA, and and not spreading the Matrigel glue for the control group. Adhesion rate = (experimental group OD450nm / control group OD450nm-1)%. Were divided into group CNE-2, CNE-2 GnT-Ⅴ / NC group and CNE-2 GnT-Ⅴ / 2224 group, the experiment was repeated a number of cases for 16.8, colony formation assay observed lowered expression of GnT-Ⅴ CNE The 2 cell radiosensitivity take dilution of logarithmic growth phase of the test cell times than each six-well plates inoculated with 200 cells, adherent cells 24 hours after receiving X-ray irradiation (0,2,4,6, 8Gy). Calculate the number of clones formed in 2 weeks after the cell survival fraction calculated by the number of clones. Experiment was divided into CNE-2 GnT-Ⅴ / NC group and CNE-2 GnT-Ⅴ / 2224 group, the number of cases for each set of duplicate 16.9, the parallel plate flow chamber detection down expression of GnT-Ⅴ CNE-2 and vascular the lower surface of the flow chamber of endothelial cell adhesion ability of a petri dish of 35mm, the upper surface of a plate made of poly (methyl methacrylate), and between the upper and lower surfaces separated by a pad of silica gel of 0.2 mm, to form a 20 mm × 2.5 mm × 0.2mm cavity. The flow chamber there is a import and export, import connection centrifuge tube containing cells, exports connected to an infusion pump to maintain a stable fluid shear stress. Be measured vascular endothelial cells cultured to logarithmic phase, the cells were digested with 0.25% trypsin, centrifuged, resuspended, seeded in a Petri dish with a diameter of 35mm. After the cell experiment covered 80% -90%. The closed vascular endothelial cells with 2% BSA for 4 hours, take on the the logarithmic phase CNE-2 GnT-V/NC cells and CNE-2 GnT-V/2224 cells, digestion, resuspended, adjusting the cell concentration of 106 / ml. 0.25 dyn/cm2 fluid shear force, the tumor cells through the flow chamber. The experimental results recorded after 5 minutes. Randomly selected 5 fields of view to calculate the quantity of adhesion of the tumor cells and vascular endothelial cells. Each set of the number of repeating Example 15.9, CNE-2 apoptosis and cell cycle after detecting silence the expression of GnT-V cells were cultured until the logarithmic growth phase, the conventional trypsin digestion, cells were collected. Embedded in paraffin. TUNEL assay to detect apoptosis according to kit instructions. Brown apoptotic cells, randomly selected five fields to calculate the rate of apoptosis. Each number of repeating Example 3. Cells were cultured until the logarithmic growth phase, the conventional trypsin digestion, cells were washed 2 times with PBS, collecting 105 cells. 50μL Binding Buffer 5μL 7-AAD dye, and mix well. The cells were collected, the 7-AAD dye mix; room temperature, protected from light, reaction 5 to 15min. The reaction mix before adding 450μL Binding Buffer. Join 1μLAnnexin V-PE mix; room temperature, protected from light, 10 min. Cell apoptosis was detected by flow cytometry. Each number of repeating Example 3. The cells were cultured until the logarithmic growth phase, the conventional trypsinization, PBS washed three times, to prepare a single cell suspension, and adjusting the cell concentration to 106/ml. Added 3ml precooling PBS resuspended cells, 800rpm × 5min, net absorption of supernatant. Add 500ul PBS, gently re-suspended cells, the cells were separated into individual, by adding 75% ethanol precooled (-20 ° C). Remove the fixed sample, 800 rpm × 5min, the supernatant was discarded. Resuspended cells and PI working solution added 3 ml of pre-cooled PBS and stained for 30 minutes at 4 ° C in the dark. Go to the the flow detector tube on the machine to detect the cell cycle. Each group repeated the number of cases of 3.10, the statistical analysis of the experimental results were confirmed by SPSS13.0 statistics software. qRT-PCR, Western-Blot. invasion assay, multiple sets of heterogeneous adhesion assay results compared using a completely randomized design analysis of variance, multiple comparisons using LSD method. Parallel plate flow chamber experiments, cell cycle and apoptosis experiments using two independent samples t-test parameters between first and homogeneity of variance test, if unequal variances based on approximate F test for unequal variances (Welch method). Cell proliferation assay, cell scratch experiments Tablet cloning experiments using factorial design analysis of variance. Due to the heterogeneity of variance, cell proliferation experiment each group of cells within 5 the multiple comparisons using Dunnett'sT3 law; homogeneity of variance, multiple comparison of the three time points in the experiment each group of cells within the cell scratch colony the formation of multiple doses of the experiment each group of cells within the multiple comparison LSD method. P lt; 0.05 represents a statistically significant difference. Fourth, the result is 1, the stability of the recombinant plasmid transfected plasmid pGPU6/GFP/Neo containing the gene encoding GFP, transfected cells under a fluorescence microscope may be excited green fluorescence. Observed under a fluorescence microscope, the cells fluoresce, indicating that stable transfection success. The interference effect analysis by qRT-PCR experiments to detect CNE-2 CNE-2 GnT-V/NC, CNE-2 GnT-V/1564 and CNE-2 GnT-V/2224 four groups of cell lines of GnT-VmRNA in The expression levels. CNE-2 GnT-V/1564 2-ΔΔCt value (0.43 ± 0.06), CNE-2 GnT-V/2224 of-the ΔΔCt value (0.33 ± 0.03), indicating that the CNE-2 GnT-V/2224 the expression level of GnT-V mRNA is less than CNE-2GnT-V/1564. Western blot results also showed that the amount of protein in CNE-2 GnT-V/2224 than CNE-2 GnT-V/1564 less. The select higher interference efficiency CNE-2 GnT-V/2224 for further experiments. CNE-2 GnT-V/NC of GnT-VmRNA and protein differences were not statistically significant. 3.GnT-V shRNA cell proliferation by Cck-8 was detected in CNE-2, CNE-2 the GnT-V/NC and CNE-2 GnT-V/2224 three groups of cell proliferation. The cell growth curve, cell growth fraction values ??at different time points (0h, 24h, 48h, 72h, 96h) and CNE-2 GnT-V/2224 growth fraction calculated. Visible CNE-2 GnT-V/2224 growth fraction than CNE-2 GnT-V/NC lower (P lt; 0.001). Described the expression of the downward GnT-V, the proliferative capacity of the cells was significantly reduced. The extended cell scratch healing time of 4.GnT-V shRNA on cell migration ability lowered the expression of the GnT-V, after the decrease of the expression of the GnT-V suppressed the migration ability of cells. Impact on cell invasion CNE 5.GnT-V shRNA-2 GnT-V/2224 groups and CNE-2GnT-V/NC group through the the Matrigel plastic and polycarbonate membrane cell number were (58.20 ± 8.53) a and (127.47 ± 9.22) (t = 21.361, P lt; 0.001). The experimental results show that the cut GnT-V expression can inhibit the invasion ability of CNE-2 cells. The 6.GnT-V shRNA CNE-2 of heterogeneous cell adhesion ability CNE-2 GnT-V/2224 group, and CNE-2GnT-V/NC group adhesion rate (35.70 ± 28.27)% and ( 70.10 ± 14.82)%, instructions down the expression of GnT-V to inhibit heterogeneous adhesion ability of CNE-2 cells. The affect adhesion 7.GnT-V shRNA CNE-2 and vascular endothelial cell adhesion capacity in vascular endothelial cells in CNE-2 GnT-V/NC and CNE-2GnT-V/2224 the number of cells, respectively (240.80 ± 29.50) and (57.60 ± 12.85), a statistically significant difference in the two. Show that lowered expression of GnT-V inhibits nasopharyngeal carcinoma cell adhesion to vascular endothelial cells. The 8.GnT-V shRNA CNE-2 radiosensitivity affect CNE-2 GnT-V/2224 group survival fraction over CNE-2GnT-V/NC group of low-and radiosensitization ratio was 1.37, indicating downward GnT- V expression increased radiosensitivity of cells. The 9.GnT-V shRNA CNE-2 cell cycle and apoptosis using the TUNEL assay calculated CNE-2 GnT-V/2224 and CNE-2 GnT-V/NC the apoptosis rate were (35.31 ± 2.61 )% and (18.97 ± 1.64)%. Draw CNE-2 GnT-V/2224 and CNE-2 GnT-V/NC the apoptosis rate by flow cytometry, respectively (26.11 ± 2.43)% and (10.80 ± 1.90)% CNE-2 of GnT- V/2224 and CNE-2 cells S phase was GnT-V/NC were (28.40 ± 0.27)% and (41.60 ± 1.74)%. CNE-2 GnT-V/2224 and CNE-2 GnT-V/NC G1 phase was respectively (59.93 ± 2.38)% and (43.43 ± 2.90)%. Down GnT-V expression after the apoptosis rate increase, the occurrence of cell cycle from G1 to S phase arrest. The experimental results show the bcl-2 protein expression in CNE-2 GnT-V/2224 than CNE-2 GnT-V/NC (53.00 ± 3.61)% reduction 10.Western blot. CNE-2 GnT-V/2224 and CNE-2 GnT-V/NC again to detect the expression of bcl-2 protein, found: after irradiation CNE-2 GnT-V/2224 in bcl-2 in the two groups of cells after irradiation reduce the amount of protein than radiation (25.33 ± 9.07)%, while the CNE-2 GnT-V/NC group of bcl-2 protein relative to GAPDH optical density values ??before and after radiation were (80.67 ± 2.52)% and (75.67 ± 6.03)%, but the difference was not statistically significant (t = 1.326, P = 0.256). CNE-2 GnT-V/2224 and CNE-2 GnT-V/NC no significant difference between the two groups of cells in E cadherin protein expression levels. Description down GnT-V expression has no effect on the amount of E-cadherin expression. V. Conclusion 1 targeting shRNA eukaryotic expression plasmid of GnT-V mRNA and protein expression of GnT-V can be lowered. Down expression of GnT-V CNE-2 cells in vitro proliferation, migration, invasion was inhibited, the increased rate of apoptosis, cell cycle arrest. 3 down expression of GnT-V cell radiation hypersensitivity may be related to the change of the bcl-2 protein. 4, down GnT-V expression had no effect on the amount of E-cadherin expression.
|