|
[Topic Background] prostate cancer (Prostate cancer, PCa) is the male reproductive system is the most common malignant tumor, the incidence rate of cancer in men in Europe and the United States the first one and the mortality rate of 2. Although the incidence of PCa is lower than Europe and the United States, but with lifestyle changes, population aging and prostate-specific antigen (PSA) screening is widely used in recent years, PCa incidence was significantly increased. Domestic a PSA screening study found that men over the age of 50 prostate cancer incidence rate 0.78%, suggesting that China's actual incidence of prostate cancer is not low. Therefore, finding an effective treatment for prostate cancer has become a pressing public health problem worldwide. Most of the protein in vivo are in the form of glycoproteins, glycoprotein sugar chain glycoprotein directly affect the biological function of the play. N-sugar chain structural change is a key step in malignant transformation of cells, in tumor cells, the structure of complex sugar chains abnormal changes, and this change is closely related with tumor invasion and metastasis. N-acetyl glycosyltransferase V (N-acetylglucosaminyltransferase V, GnT-V) is associated with tumors and tumor metastasis enzymes, studies show that GnT-V increases in many malignant tumors, and its product GIcNAcβ1, 6Manαl, 6 Structure conducive to the extension of the chain has been found that the structure of the malignant transformation and tumor metastasis of. Gene therapy is a promising cancer treatment, RNA interference (RNA interference, RNAi) technology is developing rapidly in recent years, a new study of gene function means that it is the use of the target gene homologous double-stranded small fragments RNA (dsRNA), namely: siRNA, transfection of target cells to promote target gene mRNA degradation, which specifically induces post-transcriptional gene silencing. The siRNA according to the template double-stranded DNA sequence cloned into plasmid transfected cells, DNA template transcribed in the cell into small fragments hairpin] RNA (shRNA), and chemical synthesis of small interfering RNA (siRNA) closed with the same gene , but the effect can take up to two months, because of its specificity and efficiency of gene therapy has become the hot spot. In this study, using RNAi principles and techniques for prostate cancer is highly expressed genes GnT-V shRNA expression plasmid transfected high metastatic potential of human prostate cancer PC-3 cells were observed RNAi on GnT-V gene expression inhibitory effect Looking for RNAi fragments inhibited efficient for finding an effective treatment for prostate cancer molecular targeted studies provide experimental evidence for a new target. [Experimental] 1, pGPU6/GFP/Neo GnT-V shRNA plasmid and identification (1) GnT-V siRNA sequence design: According to the NCBI database GnT-V gene known sequence (NM 0 02410.3) and siRNA design principles, the design for the GnT-VcDNA RNA fragments, having the sequence: GnT-V/1079 sense'GGAAGTGCATGCAACTGTTTA 3 '; confirmed by Blast search of the human GnT-V other than None of the known genes origin. The sequence of one pair are arranged disrupted by Blast analysis no more than 70% homology to a sequence, the interference as a negative control sequence, of: GnT-V/NC sense5'GTTCTCCGAACGTGTCACGT 3 '. The adoption by the chemical synthesis on Hai Jima synthesized above siRNA. (2) shRNA design template DNA transcription: Based on the previously designed siRNA sequences designed template DNA strand, respectively, the order of restriction sites Bbs Ⅰ, sense sequence, 9nt loop linking sequence, antisense sequence, RNA polymerase terminator Ⅲ (6 T), BamH Ⅰ restriction sites. (3) plasmid pGPU6/GFP/Neo GnT-V Construction and identification: first two of each group template single strand annealing treatment, and then double-digested with pGPU6/GFP/Neo plasmid to construct a recombinant plasmid. The recombinant Escherichia coli DH5α, kanamycin-resistant clones were screened using restriction endonuclease Bbs Ⅰ and BamH Ⅰ restriction enzyme digestion and sequencing of recombinant plasmid. A large number of bacteria after shaking amplification was extracted plasmid purification. 2, cell culture and transfection of human prostate cancer cell line PC-3 containing 10% fetal bovine serum in RPMI 1640 medium, 37 ℃, 5% CO2 humidity for a week passaged 2 or 3 times. PC-3 cells cultured to logarithmic phase, referring invitrogen company Lipofectamine2000TM product brochures, the plasmid liposome Lipofectamine2000TM into PC-3 cells. 3, the interference effect detection (1) Semi-quantitative reverse transcriptase polymerase chain reaction (RT-PCR) detection of GnT-V mRNA expression in transfected successfully, PC-3 cells cultured for 48h, cells were collected by Trizo1 step extraction of total RNA, AMV reverse transcription using cDNA, PCR reaction. GnT-V upstream primer 5'AACTCTTGGACCATCCTGGGTTC3 ', downstream primer 5'TTGCTGCTTTTGGGTGGGTT 3', product length of 555bp. PCR conditions: 94 ℃ denaturation for 5min, 94 ℃ denaturation 30s, 40 ℃ annealing 30s, 72 ℃ extension 30s, a total of 30 cycles; further extension at 72 ℃ for 10min. To β-actin as an internal, upstream primer 5'GAMCTACCTTCAACTCCATC3 'downstream primer 5'CGAGGCCAGGATGGAGCCGCC 3', product length of 219 bp. 3μl amplification products to a 2% agarose gel electrophoresis, after recording using Image. Pro Plus 6.0 software for optical density analysis, using GnT-V/β-actin gray as the ratios of the relative expression of GnT-V level. (2) Western blotting (Western blot) detecting expression of GnT-V After transfection, PC-3 cells cultured for 72h, each collection of 1 × 107 cells, the cell lysate protein was extracted and quantified. Taking 50μg total protein by SDS-PAGE electrophoresis is completed, and transferred to a PVDF membrane, 5% nonfat milk PBST buffer closed PVDF membrane. Then goat anti-human GnT-V protein polyclonal antibody (1:200), mouse anti-human GAPDH monoclonal antibody (1:1000) 4 ℃ overnight incubation, respectively, after washing the membrane HRP-labeled rabbit anti-goat IgG (1 : 400), HRP labeled goat anti-mouse IgG (1:9000), with shaking at room temperature 1h, according to the instructions using a chemiluminescent substrate for color imaging, negative scan using Image. Pro Plus 6.0 software for optical density analysis, GnT-V with GnT-V/GAPDH represents the relative expression level. 4, GnT-VshRNA on PC-3 cell proliferation, adhesion and invasion of (1) CCK-8 cell proliferation assay in each group measured in logarithmic growth phase cells, CCK-8 analysis at different time points ( 0h, 24h, 48h, 72h, 96h) cell viability at each time point were detected eight wells. OD450nm values ??measured in both groups, growth curve, and calculate the interference group growth inhibition rate. Cell growth inhibition rate (IR) = (control group OD450 value - the value of the interference group OD450) / OD450 values ??of the control group × 100%. (2) heterogeneous adhesion assay of each group measured in logarithmic growth phase cells, each Let 24 holes. Cells were cultured overnight in serum-free RPMI1640. Matrigel glue 50μL / Hole Shop 96, 10g / L BSA closed after boiling 13min denaturation at 5 × 103 / well of cell suspension, 37 ℃ incubated for 1h. Washed three times with 1 × PBS, CCK-8 OD450nm values ??measured in each group. (3) chemotaxis experiments logarithmic growth phase of the cells with serum-free RPMI1640 culture overnight. 24-well chemotaxis through the chamber to detect cell migration, chemotactic factor of 10% fetal bovine serum. Results are expressed as the number of cells through the polycarbonate membrane under a microscope each duplicate wells were randomly selected five high-power field count (400 ×). (4) wound healing experiments measured in logarithmic growth phase cells, cells were seeded in Collagen Ⅳ coated 6-well plates, cultured cells showed adherent monolayer growth state. In each group were scratches on the single cell level, using a medium containing 10% FBS and cultured to allow wound healing. Were scratches after 0h, 12h, 24h, 36 h each hole horizons to take four pictures, observe wound healing ability to use healing rate represents the ability to heal. Healing rate = [(cell layers from both sides before healing - healing both sides of the cell layer distance) / cell layer on both sides before healing distance] × 100%. (5) cell invasion assay cells in logarithmic growth phase, with no serum RPMI1640 culture overnight. Through 24 holes chemotaxis chamber and matrigel gel detection of cell invasiveness. Results are expressed as plastic and polycarbonate membrane through matrigel number of cells under a microscope each duplicate wells were randomly selected five high-power field count (400 ×). [Statistical methods] experimental data to x ± s said, using SPSS13.0 software for statistical analysis, the two groups were compared using t-test, analysis of variance was used to compare multiple groups, P lt; 0.05 indicates significant difference. [Results] 1, recombinant double digestion and sequencing the recombinant plasmid pGPU6/GFP/Neo GnT-V/1079, pGPU6/GFP/Neo GnT-V/NC with Bbs Ⅰ and BamH Ⅰ double digestion products were digested electrophoresis and found that recombinant fragment has been successfully inserted. Sequencing results with the design sequence exactly matches the target sequence contained accurate. The results showed that GnT-V shRNA and negative control shRNA vector was successfully constructed on pGPU6/GFP/Neo recombinant plasmids were successfully constructed. 2, siRNA pGPU6/GFP/Neo stable transfected GFP-encoding gene contained in, the transfected cells under a fluorescence microscope, the green fluorescence excitation. In the fluorescence microscope, the transfected cells were all fluorescence, indicating stable transfected. 3, GnT-V siRNA of PC-3 cells in GnT-V mRNA and protein expression in terms of PC-3 GnT-V/1079 cells GnT-V gene expression of PC-3 GnT-V/NC significantly lower , indicating that transfection of GnT-V shRNA vectors can inhibit expression of the target gene mRNA. Western blot analysis also showed that transfection of GnT-V shRNA vectors can inhibit the expression of GnT-V. Image-Pro Plus 6.0 software analysis GnT-V gene mRNA and protein expression levels are calculated according to the formula displayed after PC-3GnT-V/1079 group mRNA levels was inhibited by 76.5%, protein 67% inhibition, and PC-3 GnT-V/NC groups were statistically significant compared to (P lt; 0.001). 4, GnT-V shRNA on cell proliferation in cells at different time points (0h, 24h, 48h, 72h, 96h) of the OD450nm value of the cell growth curve and calculate the PC-3 GnT-V/1079 growth inhibition rate, showing that GnT-V shRNA on the proliferation of PC-3 cells was significantly inhibited, especially as the 48h, compared with the control group were statistically significant (P lt; 0.001). 5, GnT-V shRNA on cell adhesion, motility and invasiveness in Matrigel plastic base film for adhesion mimic experimental results show reduced expression of GnT-V PC-3 cells can enhance the adhesion of (t = -2.361, P lt; 0.05), and significantly inhibited PC-3 cell chemotactic motility (t = 15.057, P lt; 0.001). Scratch experiments have shown to inhibit expression of GnT-V significantly extended PC-3 cells in the healing time. Glue with Matrigel invasion mediated experimental results show that, PC-3 GnT-V/1079, PC-3 GnT-V/NC of penetrating cells were (6.20 ± 1.70) months and (37.90 ± 3.46) months, PC-3 GnT-V/1079 group penetrating cells compared with the negative control group was significantly decreased (t = 36.733, P lt; 0.001), showed reduced expression of GnT-V significantly inhibited PC-3 cell invasion. [Conclusion] 1, targeting GnT-V shRNA expression vector can be significantly reduced human prostate cancer PC-3 cell GnT-V mRNA and protein expression. 2, reduced the expression of GnT-V rear, PC-3 cell proliferation, migration and invasion is inhibited. 3, has a high inhibition efficiency of GnT-VsiRNA sequences may be an effective target for the treatment of prostate cancer.
|