Dissertation > Excellent graduate degree dissertation topics show

The Role and Mechanism of Er (Endoplasmic Reticulum)-derived Transcription Factor CHOP in Hypoxia Reoxygenation Induced Inflammation in Renal Tubular Epithelial Cells

Author: TongYuNa
Tutor: HeZuoNi
School: Third Military Medical University
Course: Internal Medicine
Keywords: endoplasmic reticulum stress CHOP hypoxia reoxygenation inflammation renal tubular epithelial cell
CLC: R363
Type: Master's thesis
Year: 2011
Downloads: 129
Quote: 0
Read: Download Dissertation

Abstract


Acute kidney injury (AKI) is a clinical critical syndrome caused by severe trauma, crush syndrome and other diseases. If the AKI develops into acute renal failure (ARF), the mortality rate will reach up to 40%~60%. It is considered that renal ischemia-reperfusion (I/R) injury is one of the important causes of AKI, and inflammation is the key pathophysiology basis in the development of renal I/R injury. Renal tubular epithelial cells as the key effector cells in renal ischemia reperfusion injury are the main source of inflammatory mediators. NF-κB is the key transcription factor to promote the expression of the inflammatory cytokines, and it plays an important part in amplifying inflammation cascade. Although research shows that the activation of NF-κB has a close relationship with the inflammation in renal ischemia reperfusion injury, inhibiting its activity couldn’t prevent renal inflammatory injury completely.Further study to elucidate pathways in renal inflammatory injury caused by I/R has significant meaning to the mechnisms and treatment of AKI.Endoplasmic reticulum is the largest cell organelle and plays an important role in maintaining intracellular homeostasis. Ischemia, hypoxia or energy deprivation will initiate endoplasmic reticulum stress (ERS). It is confirmed that excessive ERS is the important mechanism of acute ischemic cardiac and brain injury, and it also closely related to acute and chronic inflammatory diseases. Researches shows that ,I/R will cause renal excessive ERS ,but its function and mechanism in renal I/R injury is unclear .CHOP is the ERS-specific transcription factor, belonging to the C/EBP transcription factor family.It is a key factor downstream of ERS pathway to regulate apoptosis. The latest studies have shown that in animal models of lung injury and acute pancreatitis and colitis, the expression of caspase-11 and caspase-1 and IL-1βactivity decreased significantly in chopgene knock out mice,their tissue inflammation also reduce. The studies suggest that excessive ER stress activating CHOP-caspase pathway plays an important role in acute inflammatory diseases. It is confirmed that IL-1βis a pro-inflammatory cytokine produced in early inflammatory response, pro-IL-1βmust be processed into mature IL-1βby inflammatory caspase(caspase-11,caspase-1) ,and in turn active IL-1βwill amplify inflammation cascade via NF-κB signal pathway. Thus, we speculate: CHOP-caspase pathway regulating IL-1βactivity may be the key pathway in ischemia-reperfusion caused inflammation in renal tubular epithelial cells.We established an in vitro model of hypoxia/ reoxygenation (H/R) in rat proximal NRK-52E cells to mimic in vivo renal ischemia-reperfusion, in order to further study whether CHOP regulates caspase expression and inflammatory signal pathway to mediate acute ischemic renal injury. It will help to illustrate the mechanism of acute ischemic renal injury and provide a scientific basis for searching new therapy strategies.Methods1. Cell cultureRat renal tubular epithelial cells (NRK-52E) were cultured in 10% FBS DMEM culture medium and 37℃, 5% CO2, 95% air incubator.2. H/R injury cell model establishmentWhen the density was over 95%, serum-free DMED was used for synchronization. After 24 hours’synchronization the cells were in serum-free and antibiotic-free DMEM and exposed to hypoxia incubatorgased with 1%O2+94%N2 +5%CO2 for 4 hours. Subsequently the cells were cultured in normal condition and reoxygenation for 1,3,6,12,24 hours. Then the cells and the culture supernatant were collected.3. Si RNA treatmentNRK-52E cells were transfected for 24 h with liposome Lipofecta mine ? 2000, CHOP siRNA (0.04μM)or control siRNA (0.04μM). Normal cells were used as controls. Inhibitory effect of CHOP siRNA on NRK-52E CHOP mRNA and protein expression was detected by RT-PCR and Western blot.4. Cell groupingCells were divided into two groups.One is control group ,H/R1 h group, H/R3 h group , H/R6 h group , H/R12 h group and H/R24 h group .The other is control group, control siRNA group, CHOP siRNA group, H/R12 h group, control siRNA + H/R12 h group, CHOP siRNA + H/R12 h group, respectively.5. Test index and methods5.1 cell activityLDH (lactic acid dehydrogenase, LDH) in culture supernatant was detected with automatic biochemistry analyzer.5.2 Real-Time Quantitative RT-PCRTotal RNA was extracted from cells with TRIzol reagent (Invitrogen, USA). A standard reverse transcriptase reaction kit (Toyobo, Japan) was used to synthesize cDNA. The primers used were(name:forward primer,reverse primer) : chop: 5’GGGAAACAGCGCATGAAGGA3’,5’GCGTGATGGTGCTGGGTACA 3’ ; caspase-11: 5’ACGGCTGAGGGCATGGAATC3’,5’AGGCCTGCACAATGATGACTTT3’; caspase-1: 5’TCGGGAGTATGGGAAGGTTGAG 3’ , 5’TCCCTTATCCAAAATGCATGCTA 3’; IL-1β:5’CGTGGCACATTCTGGTCAAA3’,5’CTCGTGACCCCCCTGAATC3’.β-actin was used as a reference gene, and the primer sequences were ACCCCGTGCTGCTGACCGAG (forward) and TCCCGGCCAGCCAGGTCCA (backward). PCR was performed using a PCR-System-9700 kit and SYBR Green PCR Master Mix (AppliedBiosystems, USA); thermal cycling conditions were 94°C for 5 min, followed by 40 cycles of 94°C for 30 s, 57°C for 30 s, and 72°C for 45 s. The relative amount of mRNA was calculated using the comparative Ct (2?ΔΔCt) method.5.3 Western blot analysisThe protein expression of GRP78, CHOP, caspase-11, caspase-1 and IL-1βwas detected by Western blot. Whole protein extracts were electrophoresed on 10% SDS-polyacrylamide gels and subsequently transferred to polyvinylidenedifluoride (PVDF) membranes. These were then blocked with 5% skimmed milk andincubated with anti-gRP78 (1:1000), anti-CHOP (1:300), anticaspase-11 (1:200), anticaspase-1 (1:1000), anti-IL-1β(1:200),or anti-β-actin(1:1000) antibodies. Detection was performed with horseradish peroxidase-conjugated goat anti-mouse IgG and goat anti-rabbit IgG and an enhanced chemilu minescence detection system.5.4 Measurement of IL-1βactivityIL-1βin the supernatants was detected by ELISA. 5.5 Cell immunofluorescence stainingThe expression of CHOP and caspase-11 in NRK-52E cells were tested by immunofluorescence double staining method visualized with laser scanning confocal microscope.Results1. H/R caused inflammatory injury and excessive endoplasmic reticulum stress in renal tubular epithelial cells1.1 H/R induced inflammatory injury in renal tubular epithelial cellsLDH expression: compared with the control group, with the reoxygenation time prolonged, the LDH leakage in NRK-52E increased, and reached to peak at 12 h after H/R. H/R24 h began to decline, but still higher than the control group(P< 0.05).IL-1βexpression: H/R1 h, the level of IL-1βin supernatant increased, reached to peak at 12 h; H/R24 h began to decline, but still higher than the control group(P< 0.05).1.2 H/R activated excessive ERS in renal tubular epithelial cellsGRP78 expression:Compared with the control group, the protein expression of GRP78 began to increase after H/R1 h, reached to peak at 12 h; H/R24 h began to decline, but still higher than the control group(P< 0.05).CHOP expression: the control group CHOP reveals the basic level expression, it began to increase at 1 h after H/R, at 6 h significantly increase, at 12 h reaches peak, and at 24 h it begin to decline. Immunofluorescence showed, CHOP located in the cytoplasm in the control group and expressed in a very low level, but it was translocated in the nuclear at 12 h after H/R .2. The expression of CHOP, caspase-11, caspase-1 and IL-1βinduced by H/R in renal tubular epithelial cells2.1 The effects of H/R on renal CHOP, inflammatory caspase and IL-1βexpressionThe precursor of caspase-11, caspase-1 and IL-1βin the control group had a basic level of expression. The mRNA and protein expression of pro-caspase-11, pro-caspase-1 and pro-IL-1βbegan to increase after H/R1 h, reached to peak at 12 h.When H/R24 h they began to decline, but still higher than the control group(P< 0.05,P< 0.05,P< 0.05). The activated caspase-11,caspase-1 and IL-1βprotein levels began to increase at 1 h after H/R, reached to peak at 12 h and began to reduce at 24 h(P< 0.05). 2.2 CHOP and caspase-11 were coinduced in H/R-treated renal tubular epithelial cellsCHOP and caspase-11 were induced by hypoxia reoxygenation in the same cells. In control group, the expression of CHOP and caspase-11 were very low and they were localized in the cytoplasm. While in H/R12 h group, CHOP was localized in the nuclei, the expression of CHOP and caspase-11 significant increased.3. Effect of CHOP gene silencing on expression of CHOP and inflammatory injury in renal tubular epithelial cells3.1 CHOP gene silencing significantly inhibited the expression of CHOPCHOP siRNA significantly inhibited NRK-52E CHOP mRNA and protein expression (P < 0.01, P < 0.01).3.2. CHOP gene silencing significantly alleviated inflammatory injury induced by H/RCHOP siRNA significantly alleviated H/R induced cell inflammatory injury, LDH and IL-1βlevels marked decreased (P< 0.05).4. Effect of CHOP gene silencing on expression of GRP78, CHOP, caspase-11, caspase-1 and IL-1βinduced by H/RCHOP siRNA significantly inhibited H/R12 h CHOP protein expression in renal tubular epithelial cells(P< 0.05),but had no effect on GRP78 protein expression(P< 0.05). CHOP siRNA significantly inhibited H/R12 h NRK-52E caspase-11 mRNA and protein expression(P< 0.05),decreased activated caspase-1 and mature IL-1βprotein expression(P< 0.05,P< 0.05)。But CHOP siRNA had no effect on caspase-1 and IL-1βmRNA expression and their precursors’protein expression. Compared with H/R12 h group and control siRNA+H/R12 h group, the fluorescent signal of CHOP and caspase-11 significant decreased(P< 0.01).ConclusionHypoxia reoxygenation can cause excessive endoplasmic reticulum stress and activate CHOP to amplify inflammation cascade in renal tubular epithelial cells. CHOP- caspase pathway may regulate IL-1βactivation after transcriptional level in H/R induced inflammation in renal tubular epithelial cells, which may be an important mechanism of acute ischemic renal injury inflammation.

Related Dissertations

  1. The Effect and Mechanism of p38MAPK Inhibitor CBS3830 on Intimal Hyperplasia in Autogenous Vein Grafts of Diabetic Rats,R587.1
  2. The Experimental Research of RNAi Technology Inhibiting Respiratory Syncytial Virus,R725.6
  3. The Function of Fuantang Treating POI in Mice Model and the Mechanism Related with Mast Cell,R285.5
  4. Correlative Study on Plasma Level of Resistin in Patients with Coronary Atherosclerosis Disease,R541.4
  5. Effects of Blockade of IL-17 in Already Established Asthma of BALB/c Mice,R562.25
  6. Endoplasmic Reticulum Stress and the Expression of Cyclin D1, HGF Receptor C-met in Mouse with Acute Liver Failure,R575.3
  7. The Function and Mechanism of Endoplasmic Reticulum Stress Pre-treatment on the Improvement of Renal Tolerance Toward Ischemia-reperfusion Injury,R692.5
  8. The Effects of ER Stress on Cell Toxicity and Htt Levels in the Stable PC12 Cells Expressing Htt586,R363
  9. Protective Effects of Huoluoxiaolingdan and Its Series Against Hypoxia/Reoxygenation Injury in Neonatal Rat Cardiomyocytes,R285.5
  10. The Effects and Mechanisms of Epoxyeicosatrienoic Acids on Endoplasmic Reticulum Stress in Endothelial Cells,R363
  11. Overexpression of ApoE4(1-272) Can Induce the Spatial Memory Impairment of Rats by Triggering the ER Stress.,R749.16
  12. Research on the Role of GSK3β in ER Stress Response of Cerebellar Granule Neurons,R363
  13. The Effect of Tunicamycin Pretreatment on Septic Neonatal Rat Cardiomyocytes Activity and Mitochondrial Function,R459.7
  14. Radioprotective Effects and Its Mechanism of Genistein on X- Ray Induced DNA Damage on Human Liver L-02 Cells,R965
  15. The Protective Effects of Endoplasmic Reticulum Stress Preconditioning on Cerebral Ischemia-reperfusion Injury in Rat Hippocampal Neurons,R743.3
  16. The Effects and Machanism of Cholesterol Overload on Visfatin Secretion from Adipocytes,R589.2
  17. The Role of Oxidative Stress and Endoplasmic Reticulum Stress on Apoptosis in Neonatal Rat Cadiocyte Induced by High Glucose,R587.2
  18. Study of the Effect and Mechanism of Protein Disulfide Isomerase in the Pathogenesis of Nonalcoholic Fatty Liver Disease in Vitro,R575.5
  19. The Effect of Heme Oxygenase-1 on the Apoptosis and the Level of CHOP in NHBE Cells of COPD Induced by CSE,R363
  20. Expression of Endoplasmic Reticulum Protein in the Rat Gastrocnemius after Downhill Running,G804.2
  21. Research and Application on the Hydraulic Vibration Shock System Based on High Speed On/Off Valve,TH137

CLC: > Medicine, health > Basic Medical > Pathology > Pathophysiology
© 2012 www.DissertationTopic.Net  Mobile