Dissertation > Excellent graduate degree dissertation topics show

The Complete Mitochondrial Genomes of the Carettochelys Insculpta and Palea Steindachneri, and Their Phylogenetic Position Within Testudines

Author: LiXiaoSan
Tutor: NieLiuWang
School: Anhui Normal University
Course: Cell Biology
Keywords: Two claws turtle Mountain steindachneri Mitochondrial genome Control area Phylogenetic
CLC: Q78
Type: Master's thesis
Year: 2010
Downloads: 39
Quote: 0
Read: Download Dissertation

Abstract


Turtles on Earth ancient form of the most specialized one reptile the extant turtles in the world, about 450 kinds. With the negative effects of humans on the natural environment, the impact of over-exploitation of medicinal and pet trade, turtles resources are dwindling, and some species are endangered, and even some types of scientists have not yet been identified, had extinction. Therefore study the turtles have important theoretical and practical significance. Vertebrate mitochondrial genome is covalently closed double-stranded DNA, about the size of 15 to 23 kb. Mitochondria has a simple structure, was maternally inherited, rarely influenced by the sequence rearrangements have become important molecular markers for the study of animal evolution and phylogeny. Date (May 2010), GenBank officially announced turtles mitochondrial genome sequence is only 34. Obviously, this is limited to the system based on the complete mitochondrial genome data research Testudines animals occurred. In this study, using PCR, LA-PCR and sequencing technology gained the two claws turtle (Carettochelys insculpta) and the mountain steindachneri (Palea steindachneri) mitochondrial genome sequence and analysis of the characteristics of the genome. The two claws turtle and Shan steindachneri, mitochondrial genome of 16 439 bp and 17 243 bp, including 22 tRNA, 2 rRNA and 13 protein-coding genes and a non-coding control region (Control region, CR). Their genome structure, gene order and base composition are similar to the typical vertebrate. Mountain Shui turtle NADH3, Gene 214 points of presence of additional nucleotide insertion, but is not found in the two claws turtle. The two claws turtle, and mountains steindachneri the control region sequences length of 972 bp and 1 736 bp, are found to terminate the associated sequence (TAS), the conserved sequence frame (CSB-F and CSB1-3), and several other conserved sequence region; two claws turtle CR 3 'end of the zone, it is found both CA and AT motif (motif) tandem repeat sequence, repetition of 9 times and 16 times, respectively; Hill steindachneri CR 5' end, there long fragment of a length of 50 bp (ATTTT ACTTT TTTTT CTCT CCCGC GCCCA AGAGATATAAAACCCCTGTAT) tandem repeat (repeat 5 times), was found at the 3 'end of the tandem repeats of TATAT motif, was repeated 43 times. In this paper, another 15 kinds of turtles animal mitochondrial whole genome sequences retrieved from GenBank, two crocodiles do outgroup, 13 based on mitochondrial protein-coding genes combined sequence data using the neighbor-joining method (Neighbor joining, NJ), maximum parsimony (maximum parsinomy method, MP), maximum likelihood (maximum likelihood method, ML) and Bayesian (Bayesian inference, BI) reconstruction of the system of turtles and trees to explore the two claws turtle and mountain Rui turtle in Testudines animals in the phylogenetic position. Testudines NJ tree and MP tree is divided into three main branches: the side-necked turtle Division (Pelomedusidae) the two claws Hydrocharitaceae (Carettochelyidae) and one by the other 15 turtles clustered into clade, this results support the two claws turtle Keti rose to the level of suborder. ML tree, however, and BI trees constitute a sister group to support the two claws Hydrocharitaceae and Hydrocharitaceae again with other curved neck turtle species common clade support today terrapin is divided into two main branches: the curved neck turtle suborder ( Cryptodira) and the side of the neck suborder (Pleurodira). This dispute has yet to be in-depth study using molecular data. 4 kinds of trees topology exactly Hydrocharitaceae (only slight differences in the size of the confidence value) are displayed the mountain steindachneri soft-shelled turtle (Pelodiscus sinensis) First of all together constitute the sister group. Then, with the Malay the turtle (Dogania subplana) Africa turtle (Trionyx triunguis), the India box turtle (Lissemys punctata) gathered. Therefore, we think that the mountain steindachneri soft-shelled turtle kinship recently.

Related Dissertations

  1. Comparison of Genetic Diversity of Total Planktonic Bacteria and Active Planktonic Bacteria in Huguangyan Maar Lake in Summer,Q938
  2. Study on Phylogenetic Diversity and Bioactivity of Symbiotic Fungi of Coral,R284
  3. Survey in Nanjing and Analysis of the Mitochondrial Genome of Frankliniella Occidentalis (Pergande),S433
  4. Establishment of the Molecular Identifying System of Curvualria and Application in Difficult Species,Q949.32
  5. Isolation and Identification of Infectious Bronchitis Virus in Henan and the Full Genome Sequence Analysis of Isolated Strains HN104 and HN091,S852.65
  6. Isolation and Identification of Avian Pathogenic Escherichia Coli from Chicken and Characterizations of Its Virulence-Associated Genes,S852.61
  7. Phylogenic Analysis of Henan Populations and Feeding Behavior Comparison of Bemisia Tabaci B and Q Biotypes,S433
  8. Identification and Lipopeptide Analysis of Biocontrol Bacillus Spp. Isolated from Tibet,S476.1
  9. Mitochondrial Genome Sequence Analysis of a Brassica Juncea Landrace,S565.4
  10. The Molecular Evolution Analysis of Genes Related with Cotton Fiber Development in Different Cotton Species in Gossypium,S562
  11. Fine Mapping of Inter-Subspecies Hybrid Pollen Sterility Gene in Rice (Oryza Sativa L.) and Phylogenetic Analysis,S511
  12. Studies on Genetic Diversity and Phylogenetic Relationship of Dendranthema and Its Related Genera,S682.11
  13. Investigation on the Diversity and Phylogenetic of Methanogens and the Relationship between Methanogenesis and Acetogenesis in the Hindgut of Pigs,S828
  14. Molecular Phylogeny of Rhus Gall Aphids (Hemiptera: Aphididae: Pemphiginae) Based on DNA Sequences,S899.4
  15. Phylogenetic Relationship and Biogeography of Thoreales Based on Gene Sequences,Q941
  16. An Improvement of Cluster on Phylogenetic Profiling Method,TP311.13
  17. Mitogenome Structure and Phylogenetic Analyses of Exorista Sorbillans,S884.62
  18. Cetoniidae (Cetoniidae) some types of gene sequences and phylogenetic relationship,Q963
  19. Vole mitochondrial genome sequence and Y chromosome partial sequence determination and analysis,Q953
  20. Isozyme Patterns in Various Tissues, Phylogenetic Analysis in Scorpaeniformes Base on Mitochondrial cyt B、COⅡof Inimicus Japonicus and Isolation and Characterization of High Polymorphic Microsatellite Markers in It,S917.4
  21. Morphology and Phylogenetic Analysis on Endoreticulatus Sp. Zhenjiang and Nosema Sp. MPr,S884

CLC: > Biological Sciences > Molecular Biology > Genetic engineering (genetic engineering)
© 2012 www.DissertationTopic.Net  Mobile