|
Turtles on Earth ancient form of the most specialized one reptile the extant turtles in the world, about 450 kinds. With the negative effects of humans on the natural environment, the impact of over-exploitation of medicinal and pet trade, turtles resources are dwindling, and some species are endangered, and even some types of scientists have not yet been identified, had extinction. Therefore study the turtles have important theoretical and practical significance. Vertebrate mitochondrial genome is covalently closed double-stranded DNA, about the size of 15 to 23 kb. Mitochondria has a simple structure, was maternally inherited, rarely influenced by the sequence rearrangements have become important molecular markers for the study of animal evolution and phylogeny. Date (May 2010), GenBank officially announced turtles mitochondrial genome sequence is only 34. Obviously, this is limited to the system based on the complete mitochondrial genome data research Testudines animals occurred. In this study, using PCR, LA-PCR and sequencing technology gained the two claws turtle (Carettochelys insculpta) and the mountain steindachneri (Palea steindachneri) mitochondrial genome sequence and analysis of the characteristics of the genome. The two claws turtle and Shan steindachneri, mitochondrial genome of 16 439 bp and 17 243 bp, including 22 tRNA, 2 rRNA and 13 protein-coding genes and a non-coding control region (Control region, CR). Their genome structure, gene order and base composition are similar to the typical vertebrate. Mountain Shui turtle NADH3, Gene 214 points of presence of additional nucleotide insertion, but is not found in the two claws turtle. The two claws turtle, and mountains steindachneri the control region sequences length of 972 bp and 1 736 bp, are found to terminate the associated sequence (TAS), the conserved sequence frame (CSB-F and CSB1-3), and several other conserved sequence region; two claws turtle CR 3 'end of the zone, it is found both CA and AT motif (motif) tandem repeat sequence, repetition of 9 times and 16 times, respectively; Hill steindachneri CR 5' end, there long fragment of a length of 50 bp (ATTTT ACTTT TTTTT CTCT CCCGC GCCCA AGAGATATAAAACCCCTGTAT) tandem repeat (repeat 5 times), was found at the 3 'end of the tandem repeats of TATAT motif, was repeated 43 times. In this paper, another 15 kinds of turtles animal mitochondrial whole genome sequences retrieved from GenBank, two crocodiles do outgroup, 13 based on mitochondrial protein-coding genes combined sequence data using the neighbor-joining method (Neighbor joining, NJ), maximum parsimony (maximum parsinomy method, MP), maximum likelihood (maximum likelihood method, ML) and Bayesian (Bayesian inference, BI) reconstruction of the system of turtles and trees to explore the two claws turtle and mountain Rui turtle in Testudines animals in the phylogenetic position. Testudines NJ tree and MP tree is divided into three main branches: the side-necked turtle Division (Pelomedusidae) the two claws Hydrocharitaceae (Carettochelyidae) and one by the other 15 turtles clustered into clade, this results support the two claws turtle Keti rose to the level of suborder. ML tree, however, and BI trees constitute a sister group to support the two claws Hydrocharitaceae and Hydrocharitaceae again with other curved neck turtle species common clade support today terrapin is divided into two main branches: the curved neck turtle suborder ( Cryptodira) and the side of the neck suborder (Pleurodira). This dispute has yet to be in-depth study using molecular data. 4 kinds of trees topology exactly Hydrocharitaceae (only slight differences in the size of the confidence value) are displayed the mountain steindachneri soft-shelled turtle (Pelodiscus sinensis) First of all together constitute the sister group. Then, with the Malay the turtle (Dogania subplana) Africa turtle (Trionyx triunguis), the India box turtle (Lissemys punctata) gathered. Therefore, we think that the mountain steindachneri soft-shelled turtle kinship recently.
|