Dissertation > Excellent graduate degree dissertation topics show

Studies on the Biotreatment of Petroleum Refining Waste Water by Bacterial Strain P-3 and Naphthalene Degradation by N-1

Author: WenHongYu
Tutor: LiaoYinZhang
School: Chengdu Institute of Biology
Course: Environmental Science
Keywords: Refinery wastewater COD Oil content Naphthalene 16SrDNA
CLC: X742
Type: Master's thesis
Year: 2005
Downloads: 150
Quote: 1
Read: Download Dissertation

Abstract


Nanchong refinery refinery wastewater activated sludge collected from the outskirts of Chengdu petroleum contaminated soil enrichment domesticated screened three better able to deal with refinery wastewater bacteria strains , numbered P-1, P-2 and P -3 Nanchong refinery refinery wastewater treatment effect compared using biofilm under laboratory conditions , the treatment effect : P -3 gt ; P - 1 gt ; P -2 , the dominant strain in P-3 and refinery wastewater activated sludge mud processing refinery wastewater compared to the better in the activated sludge . The study showed that the P - 3 Refinery Wastewater Treatment optimal conditions : temperature 30 ℃ -35 ℃, pH 8.0 . 30 ℃, ventilation 1.25L/min , pH 8.0, under the experimental conditions , refinery wastewater by strains of P-3 treatment after the initial oil content reduced to 0.009 from 0.285 , the removal rate of 97% ; COD value from the initial 402.16 mg / L reduced to 81.17 mg / L, the removal rate of 80% . To complete removal of polycyclic aromatic hydrocarbons in the refinery wastewater naphthalene matter enrichment domestication of petroleum-contaminated soil and refinery wastewater activated sludge , naphthalene-degrading isolates were screened out N-1 and N-2, the experimental results show that the strain N-1 degradation efficiency is significantly better than the N-2, and the basic refinery wastewater activated sludge does not degrade naphthalene . Through a systematic study of the N-1 degradation of naphthalene , the optimum growth conditions : pH 8.0, temperature 35 ° C , at 180rpm, add a 0.1% solution of trace elements and nitrogen sources for the NH 4 NO 3 degradation efficiency degradation efficiency 94.7% when the naphthalene concentration of less than 500mg / L . Through P-3 and N - 1 of morphological observation , physiological and biochemical characteristics experiment , the initial P-3 classified as the genus Pseudomonas (Pseudomonas ) , N -1 classified as Micrococcus ( , Micrococcus ) . 16SrDNA, of the P-3 and N-1 is amplified by PCR and detect the modified universal primers P1 (AGAGTTTGATCCTGGTCAGAACGAACGCT) and P6 (TACGGCTACCTTGTTACGACTTCACCCC) the specificity of the experimental results described in this pair of primers amplified strain P - 3 and of N- 116SrDNA there are good specificity .

Related Dissertations

  1. Software Design of Muliparameter On-Line Monitoring System in Water-Quality,TP3
  2. Studies on Phytoremediation of COD and Ammonia-Nitrogen in Coking Wastewate by Six Aquatic Plants,X784
  3. TiO 2 nano flowers and HAP / TiO 2 Preparation, Characterization and Photocatalytic Degradation of Organic Pollutants,O643.32
  4. Prostate Secretion Laboratory Inspection in Chronic Prostatitis Etiology Research,R697.33
  5. Uygur four kinds of normal human intestinal microflora fluid mass distribution characteristics of,R291.5
  6. The Application of Biological Aerated Filtering Technology on Wastewater Treatment for Reuse in Refinery Factory,X703
  7. Experimental Study of an Anoxic/aerobic Membrane Bio-reactor,X703
  8. Equipment Development and Research in an Airlift-Reflux Combined Reactor,X703
  9. Iron-catalyzed Synthesis of Arylsulfides or Arylselenides and Zinc-catalyzed Synthesis of Naphthalene Derivatives,TQ241.51
  10. Examining of the Excellent Phosphate-solubilizing Bacteria in Soil of Dong Qi Lian Shan Alpine Meadow,S812.2
  11. Monosodium glutamate wastewater for mushroom liquid fermentation research,S646.15
  12. Analysis on the Adnascent Microorganism Flora of Grape Leaves and Screening of Antagonistic Strain to Botrytis Cinerea,S436.631
  13. Studied on Pathogen of Onion Bacterial Bulb Soft Rot and Agricultural Control,S436.33
  14. Material Transport and Study of Dynamic Mechanism in the Yangtze River Estuary,TV148.1
  15. Application of Flocculation Precipitation Process on the Water Treatment Project in Haixin River,X52
  16. Research on Treatment of Oily Sludge from Liaohe Petrochemical Branch,X703
  17. Study on Primary Biological Functions of Endophytic Bacteria in Preponderant Grasses on Alpine Grassland,S812
  18. Identified of Enterococcus Faecalis Isolated from Septicemia Geese and Prokaryotic Expression of Cytolysin Activator,S858.33
  19. Screening, Purification and Characteristics of a Cold-adapted Lipase,Q814
  20. Synthesis and Characterization of a Epoxy Resin Containing Naphthyl/Dicyclopentadiene Moieties and Upgrade of Its Capability,TQ323.5
  21. Pear ring rot biocontrol strains and their role in prevention research,S436.612

CLC: > Environmental science, safety science > Processing and comprehensive utilization of waste > Oil, gas, industrial waste treatment and comprehensive utilization > Petroleum refining
© 2012 www.DissertationTopic.Net  Mobile