Dissertation > Excellent graduate degree dissertation topics show
Studies on the Biotreatment of Petroleum Refining Waste Water by Bacterial Strain P-3 and Naphthalene Degradation by N-1
Author: WenHongYu
Tutor: LiaoYinZhang
School: Chengdu Institute of Biology
Course: Environmental Science
Keywords: Refinery wastewater COD Oil content Naphthalene 16SrDNA
CLC: X742
Type: Master's thesis
Year: 2005
Downloads: 150
Quote: 1
Read: Download Dissertation
Abstract
|
Nanchong refinery refinery wastewater activated sludge collected from the outskirts of Chengdu petroleum contaminated soil enrichment domesticated screened three better able to deal with refinery wastewater bacteria strains , numbered P-1, P-2 and P -3 Nanchong refinery refinery wastewater treatment effect compared using biofilm under laboratory conditions , the treatment effect : P -3 gt ; P - 1 gt ; P -2 , the dominant strain in P-3 and refinery wastewater activated sludge mud processing refinery wastewater compared to the better in the activated sludge . The study showed that the P - 3 Refinery Wastewater Treatment optimal conditions : temperature 30 ℃ -35 ℃, pH 8.0 . 30 ℃, ventilation 1.25L/min , pH 8.0, under the experimental conditions , refinery wastewater by strains of P-3 treatment after the initial oil content reduced to 0.009 from 0.285 , the removal rate of 97% ; COD value from the initial 402.16 mg / L reduced to 81.17 mg / L, the removal rate of 80% . To complete removal of polycyclic aromatic hydrocarbons in the refinery wastewater naphthalene matter enrichment domestication of petroleum-contaminated soil and refinery wastewater activated sludge , naphthalene-degrading isolates were screened out N-1 and N-2, the experimental results show that the strain N-1 degradation efficiency is significantly better than the N-2, and the basic refinery wastewater activated sludge does not degrade naphthalene . Through a systematic study of the N-1 degradation of naphthalene , the optimum growth conditions : pH 8.0, temperature 35 ° C , at 180rpm, add a 0.1% solution of trace elements and nitrogen sources for the NH 4 sub > NO 3 degradation efficiency degradation efficiency 94.7% when the naphthalene concentration of less than 500mg / L . Through P-3 and N - 1 of morphological observation , physiological and biochemical characteristics experiment , the initial P-3 classified as the genus Pseudomonas (Pseudomonas ) , N -1 classified as Micrococcus ( , Micrococcus ) . 16SrDNA, of the P-3 and N-1 is amplified by PCR and detect the modified universal primers P1 (AGAGTTTGATCCTGGTCAGAACGAACGCT) and P6 (TACGGCTACCTTGTTACGACTTCACCCC) the specificity of the experimental results described in this pair of primers amplified strain P - 3 and of N- 116SrDNA there are good specificity .
|
Related Dissertations
- Software Design of Muliparameter On-Line Monitoring System in Water-Quality,TP3
- Studies on Phytoremediation of COD and Ammonia-Nitrogen in Coking Wastewate by Six Aquatic Plants,X784
- TiO 2 nano flowers and HAP / TiO 2 Preparation, Characterization and Photocatalytic Degradation of Organic Pollutants,O643.32
- Prostate Secretion Laboratory Inspection in Chronic Prostatitis Etiology Research,R697.33
- Uygur four kinds of normal human intestinal microflora fluid mass distribution characteristics of,R291.5
- The Application of Biological Aerated Filtering Technology on Wastewater Treatment for Reuse in Refinery Factory,X703
- Experimental Study of an Anoxic/aerobic Membrane Bio-reactor,X703
- Equipment Development and Research in an Airlift-Reflux Combined Reactor,X703
- Iron-catalyzed Synthesis of Arylsulfides or Arylselenides and Zinc-catalyzed Synthesis of Naphthalene Derivatives,TQ241.51
- Examining of the Excellent Phosphate-solubilizing Bacteria in Soil of Dong Qi Lian Shan Alpine Meadow,S812.2
- Monosodium glutamate wastewater for mushroom liquid fermentation research,S646.15
- Analysis on the Adnascent Microorganism Flora of Grape Leaves and Screening of Antagonistic Strain to Botrytis Cinerea,S436.631
- Studied on Pathogen of Onion Bacterial Bulb Soft Rot and Agricultural Control,S436.33
- Material Transport and Study of Dynamic Mechanism in the Yangtze River Estuary,TV148.1
- Application of Flocculation Precipitation Process on the Water Treatment Project in Haixin River,X52
- Research on Treatment of Oily Sludge from Liaohe Petrochemical Branch,X703
- Study on Primary Biological Functions of Endophytic Bacteria in Preponderant Grasses on Alpine Grassland,S812
- Identified of Enterococcus Faecalis Isolated from Septicemia Geese and Prokaryotic Expression of Cytolysin Activator,S858.33
- Screening, Purification and Characteristics of a Cold-adapted Lipase,Q814
- Synthesis and Characterization of a Epoxy Resin Containing Naphthyl/Dicyclopentadiene Moieties and Upgrade of Its Capability,TQ323.5
- Pear ring rot biocontrol strains and their role in prevention research,S436.612
CLC: > Environmental science, safety science > Processing and comprehensive utilization of waste > Oil, gas, industrial waste treatment and comprehensive utilization > Petroleum refining
© 2012 www.DissertationTopic.Net Mobile
|